Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig2124
Contig Information
Length 1346 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 7 Clones [Download: CSV  ,  FASTA ]
whec10d23    whec3b20    whec4n06    rwhec10d23    rwhec3b20    rwhec4n06    rwhec4n17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0156300 [Oryza sativa (japonica cultivar-group)] >gi|54291859|gb|AAV32227.1| putative disulfide-isomerase [Oryza sativa (japonica cultivar-group)] >gi|57863918|gb|AAS55771.2| putative disulfide-isomerase [Oryza sativa (japonica cultivar-group)] >gi|113578247|dbj|BAF16610.1| Os05g0156300 [Oryza sativa (japonica cultivar-group)] >gi|215678906|dbj|BAG96336.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215692773|dbj|BAG88199.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215704383|dbj|BAG93817.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218196130|gb|EEC78557.1| hypothetical protein OsI_18529 [Oryza sativa Indica Group]
Score 1560
Evalue 2.87315e-171
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig2124
GTTTGTTCTTGAGTAAACCCTTTTACTGCTAAAGTAAATCCCTGTAACCGAAAAGGTAAACGGCTGAGAAAACAGATATCAGATGTTGTTCAACATTGAA
CCAAAACAGATAATCTATTGCCGCTAAACTTTCACTGCCATCTCTCTGATCTCTATTTCTCTTTGTCTTTCTTCACTTCTCTCTTGTGGCAGGCGGTACT
GTTGTACTACTGACTACACCCCCAACAATGGCAGGGCTGGGGCACGTGGGTCATCACCATTAAGAGGAGAAGGCTGAAAGAATGTTCTTCTTGATGGCGA
ATTCATCGGCTTTGGAAGGACTGATCGACTTCTCCAACAAGCGATGAAGCCTCTCAGTTTCCTTCTTGGTATAGTCAGAGCCCTTCTGCAATATCTTCTT
TGCAACATTCACATAGATCTTTCCATGCTTGACAGCAGGACCACTGAGCTTCGCAGCCTCCTCTTCAATTTTAGAGAGGATTTCCTTCCGCTTGTCATCA
GCAGCACTGTGGAATTCCTTGACAAGAGCATCCAAACTTGCCACAAGCCCAGCCTCTGAAGTAAGCTGACCCTTTGAATCACGGCTAGTTCCACTTTTCT
CATTAATGAACTTAACAAAGTCATCCAACTCCCGACCGCTCTCATACTCTTCACCAGCTTTGTTACCCTTCGGGAAGAACTTCAATGTGGGAAAACCAGA
AACTCCATACTTCTCAGCCAAGCTTGTGTATTTGTCTGCATCAAGATTAGCAATCACGACACCCTCATCTTGCTTGAAAACAGAGGCCACCTTCTCATAT
ATCGGAGCAAGACTCTTGCAGTGACCACACCATGGGGCATAGAACTCAACAAGGACATCTTTGGTTTCATCAAGGACAACCGAGTCAAAGGTTTCCTCGG
TCAGAACCACAACACTTGAAGGAACTGCGGCTATCTTCACATTGGTTGCTGCTTCAGAGTTAACATATTCTGTAAGGGCTTCAGCAGTGCGTTGACCCTC
ATACTTCTTGGGCTCCAAGGAACCTTTGGGAAACCACTGGATTGTGGGGTAGCCAGAAACTCCATACTTGCTGCACACACTCTTGTGCTCATCGCAGTCA
ACCTTGGCAATCAAGACTGATTTAGCCTTTTTAAAACTTGCAGCAAGCTTCTCATATTCTGGAGCAAGCTTCTTGCAGTGGCCACACCAGGGAGCGTAGA
ACTCGACGAGTGCGCCACGATCCTGGCCGACCTCCTTCTCGAAGGTGGACTCCGTGAGGGCAAGCACCTCGTCGCCGTCGGCGGCGGCTGGGTAGAGCGC
CGCGGCCGCGAGCAGGAGGAGGAACGGGGAGGAGGGTTTTGCGGTA
page-top