Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig2121
Contig Information
Length 803 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 7 Clones [Download: CSV  ,  FASTA ]
whec6g18    whec16f24    rwhec11l09    rwhec6a20    rwhec16f24    rwhec19b20    rwhec20k14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_28114 [Oryza sativa Indica Group]
Score 400
Evalue 4.11332e-37
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig2121
ACATATATAGTAGAATTCTGGCATTACAACATATAGCGGCAAGAAAATACTACAGACAAATGATACTAGGTCCACTAGGATAATGGGAAACACGGGGATA
CAGTCGTCTAGACACGCGGCAGTTGCATCAGACCATTTTGTGGCTCAAAAAGTTTCTAATCGTCACCAAATGTGGTCTTCTTCCCTGCGCTAGCTGTGCC
AGCACTCTGTCTGCTCTGAAAGCCTCGGCCGCCTCCTCTGCCGCCATCACGGCCACCAGACCGGCCAAACCTGCCGCCACCATCACGGCCACCAGACCGG
CCAAACCTGCCGCCGCCATCACGGCCACCAGACCGGCCAAACCTGCCACCACCAGAGCGGCCACCATCTCTGCCACCAGATCGACCACCAACGCCACCAA
ATTGACCCTTAGGCTTAGCTTCGGCAACATACAAGTTGCAGCCACCTAGGTCAGATCCACTAAGCTCAAGTGCTTTCGAAAAGGAACTCTCATCAGTAAA
ATCCATGTAAGCTATCCCTTTGCTTGCACCATTCTCATAATCCATCGGAACTGAGACACGTGTGATTTCTCCACATTTAGAGAAGTGTTCTTGAAGAGAG
CTCCGAATAGCATCCTCCTGTTGAGATGAATCAAAACCCTTGACAAATACTGAGAGGCTGGGACCTCCACTTGGTTTTCCAAACGATCCACCATCCCTGG
TGCGAGGAGTTGCACCTCTTTCAGCAGCCATGTCAAGTCTCACCGGACGGCCCATTAGATCTCCACCATTCAGTGAATCAAGCGCTTTCTGAGCATCTTC
AGC
page-top