Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig2100
Contig Information
Length 788 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 6 Clones [Download: CSV  ,  FASTA ]
whec10a14    whec4f19    whec17i18    rwhec10a14    rwhec4f19    rwhec17i18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Late embryogenesis abundant protein 1
Score 477
Evalue 4.72521e-46
Total Hit Count 379
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig2100
GACGCCTTGGCTGGGAAGACGCAGGAGGCCAAGGACACCACCATGCAGAAGGCCCAGCAGACGAAGGACGCCGCCGCCGAGAAGGCGAGGCAGACCAAGG
ACGTGACACAGCAGAAGGCGGGCGAGTACACGGACGCCACCAAGGGGACCGCGCAGGAAGCTAGGGACAGGACCATGGCGACCACGCAGACCGCCGCCGA
CAAGGCAAGGGAGACGGCCGGCACCCACGATGCCGATAGGGGTCAGCAAGGGACCGGTCTGTTCGGGGCGCTGGGCAACATGACGGGCGCGATCAAGGAG
AAGCTGACGGTTGGCTCAGGCACGCAGAAGCACGACGCTGGAGGGCACGGCCTCCGGCTGGGCGACGAGGACGAGCGCGCGGTGAAGGAGCGCGCGGCGG
AGAAGGCTGCGTCCGTCTACTTCGAGGAGAAGGACCGGCTGGCCAAGGAGCGCGCGGCGGAGCGGGTGGACAAATGCGTCGAGAAGTGCGTGGAAGGGTG
CGCCGGCTCCTCCTGCGCCCACCGCAAGGGCAAGATGTGAGCGGCCGGGCGTCCCACGTGACCGACCGCGGGCGCGTCCTCGGTGCGACGTGCACACGTA
TCGCGTTCTCGTGCCATCCATGCCGTCACTCCGAGCATGGCGGCGACAATAAACTTTAACTCCTAGTGGAGGTCCAGTAGAGCCTTCGTTTTCAAGTTTC
TTTTACTACCACCTTTTGTCTAAGTAGTGTAGTGTGTGCGCGTCCCTTAGTTTGAATCCATAAATGTCCTTCGGTTTCAAAAAAAAAA
page-top