Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig2076
Contig Information
Length 925 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 6 Clones [Download: CSV  ,  FASTA ]
whec10c04    whec11b08    rwhec10c04    rwhec11b08    rwhec14h01    rwhec14h02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit small Ras-related GTP-binding protein [Triticum aestivum] >gi|19919694|gb|AAM08320.1|AF488730_1 small Ran-related GTP-binding protein [Triticum aestivum]
Score 1053
Evalue 1.01367e-112
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig2076
ACAGGCATAATAATACTGATGAACCATCAAGGTGGCGAACAACAAATCCATGGCAAGCAACATGATGTAGATCAATGTCACACAAACAGTTTGCAGCCCA
CCAGACAAGGCAAGGCAGACAGGAAAAACATCCGGCTTGACTACTCCATATCAAGCCTTCAACCTAAAACCGACTCGCATAGTCTCTGGCTCTCAAAGTA
TTGATTGATAAGACAGACTCATGATCCTCTCTCTACTCGATCAGATCGTCATCGTCATCAGGCAGTGGCTGTGCCGCTGCAGCCGCAAGCTCAGCCTCGT
GCTGTTGCTGCATGGCCAAGTCGAAGGTCACTTCCGGAGGCTTAAGGGCCACTGCTTCGACGAAGTGGATGTTGGGATCACCAGCCAGCTTCCTAGCAAG
GTAAAGGAAGGGCTTCTCAAAGTTGTAGTTGCTCTTGGCAGAGATTTCATAGTACTGGAGGTTCTTCTTCCTGTGGAATGTCACCTGCTTGGCCTTAACC
TGCCTGTTCTTCACATCAACCTTGTTGCCACACAGCACAATGGGGATGTTCTCACAAACCCTGCACAAGTCCCTGTGCCACGTAGGAACATTCTTGTAGG
TCAGCCTTGAAGTGACATCAAACATGATAATCGCACACTGACCATGGATATAGTATCCATCCCTAAGGCCACCAAACTTCTCTTGCCCAGCAGTGTCCCA
GCAGTAGAAACGGATCTTTCCACAGTTAGTGGTGAAATCCAACGGGTGAACTTCAACACCAATGGTGGGTTCGTATTTCTTCTCAAACTCTCCAGTGAGA
TGCCTCTTCACAAATGTGGTTTTGCCAGTCCCGCCATCGCCGACGATGACGAGCTTGAAGCTGGGGTAATCGACGGTGTTCTGGTTCGGCAGCGCCATGG
TGGACGCGGGCGGCGACGGCGGCGG
page-top