Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig2011
Contig Information
Length 755 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 5 Clones [Download: CSV  ,  FASTA ]
whec10c17    whec10c18    rwhec10c17    rwhec10c18    rwhec10d06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit surface antigen 5, putative [Toxoplasma gondii ME49]
Score 83
Evalue 2.10347
Total Hit Count 11
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig2011
AAACCAAAAAGTCAAGCAAGAATTTGATAGGGCATCTAAGCCACGATAACATTCAGTCACGTTGGTATGCAGTGTTGGTAGGGCGAAATGTGTCAATGCC
ACGATAACATCCACATGTCCACCGTCATGCCTCCCCGGCTCCTCCTGTCAACCACGCGCCTCTGCCAGCAGACGTAGATTCGGCACTGGCCTCTGCCATG
GCGTGTCCCCACCTTCCTCTTCGCGCCTGTAGGAGAGGCATCGCCTCAACAAACAGTACTACGAATGAACATTGCAATATTTGTTCATAGTAAATAATCC
TTGTACGTCAGAAACCAGAAATTTTGTGTCAGTGTGTTTCGTGAGAAGAGGACGCCAATCCGTCCATCCAGAAATCACAACCCTCCATTACTACTGCCAG
CATCATGCCATTAACTGGTTCTGTAAATCCAGTAGATCATAATCCTTCGTGGCAACAAGGAGGGCCAAACGTTTATGTTCTGGCAGTAGATATCACTACC
ATGACCACTGCCTCAACGACTAACTTCCAGGTTCAGTATTGCAGGTCCTCATATATGCCATCAAGACGATCAGAAGACATATAGCCGTTAGTGATGTTTA
AGACAGCGACCAGAGCTTGTAGAGTTAGTCGTTGGGTTTTGCTTCTCTACCACAGCAGCTCCGTCATGCGCGAGGTTCTTGCACTGGTACTGCTGCCCAT
GCACTCTGCAACTTTGCCTTCGACAATCTACATCGTCCTGAAGTCCCGGTGCTCT
page-top