Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig1996
Contig Information
Length 707 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 5 Clones [Download: CSV  ,  FASTA ]
whec10e17    whec3o05    whec4o05    rwhec10e17    rwhec3o05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 60S ribosomal protein L24 >gi|1154859|emb|CAA63960.1| L24 ribosomal protein [Hordeum vulgare subsp. vulgare]
Score 563
Evalue 4.04839e-56
Total Hit Count 457
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig1996
GCCGCCGCGCCTCCTCCTCGCCCAAGGTAGGAGCTTGTGAAAGTTCTCTAAGGCTGAGAAGATGGTTCTGAAGACCGAGCTCTGCCGTTTTAGCGGCCAG
AAGATTTACCCTGGGAAGGGTATCAGGTTCATTCGTTCGGATTCGCAGGTTTTCCTCTTTGCCAACTCAAAATGCAAGCGCTACTTCCACAACCGCCTGA
AGCCTGCAAAGCTTTGCTGGACAGCAATGTACAGGAAGCAGCACAAGAAGGACATCCATGCTGAGGCTGCCAAGAAGAGGCGCCGCACCACCAAGAAGCC
GTACTCACGGTCGATTGTTGGTGCCACTCTGGAAGTTATCCAGAAGAAGAGGGCTGAGAAGCCTGAAGTCCGTGATGCTGCCCGAGAAGCTGCTCTCCGT
GAGATCAAGGAGCGCATCAAGAAGACCAAGGATGAGAAGAAGGCCAAGAAGGCAGAGGTGACCAAGTCCCAGAAGTCACAGGGGGGCAAGGGCGCCGTGC
AGAAGGGTTCCAAGGGCCCAAAGATTGGCGGTGGCGGCGGGAAGCGTTGAAAGTCGATTACGCCATAGACATAGAATTGTGCTGCCTAGCCTTGTTTCCT
ATCCTACTATCATAGACCTTTGTCAAGTTATTACCCCGCCATCTTGAATTTGCACCTTATCTGTGAGGCTGAATGGTGTTAACGTTTTGGATTGTCTAAA
AAAAAAA
page-top