Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig1986
Contig Information
Length 453 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 5 Clones [Download: CSV  ,  FASTA ]
whec10e24    whec5a04    rwhec10e24    rwhec10f11    rwhec5a04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative 60S ribosomal protein L39 [Oryza sativa Japonica Group]
Score 295
Evalue 1.86218e-25
Total Hit Count 222
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig1986
TTTTTTTTTTAACAAGGGTGGCATATAGCAAAGGTTCTTTACTTGGCACAGCATGGTAACATGAGTACACCAGAGTACAAGCAATCCTCATGACATAGAC
GAAATTGATAACAGAGACAGCATCCTGGAATCACTTCCTAGCTTGCATAACAAACACTAAAACGTCCATAAAACAAAATGCAGATAAGTCTTGGAACCAT
GGCTCCCCCACGCGGCGGTCGGCAGGTACGGATCTAGAACCCGAGCTTGGTGCGGCGCCAGTGCCTGCGCTTCGCGTTGTACCTGATGGTGTTGTCGGTC
CGCATGCGGATCCAGTAGGGGATGGGGCGGTTCTGGCGCTGCTTCTTGGCCAGCTTCTGCTTGATGCGGAAGGTCTTGTGGGACGGCATCGTCGCGGCGG
AGACGAAGACGCGGCAGCGGCTTCGGCGGCGGCGGCGGCGGCGGGAGCAAAAC
page-top