Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig1981
Contig Information
Length 598 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 5 Clones [Download: CSV  ,  FASTA ]
whec10c08    whec18f10    whec18k09    rwhec18f10    rwhec18k09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0674200 [Oryza sativa (japonica cultivar-group)] >gi|34393853|dbj|BAC83533.1| putative 60S ribosomal protein L22 [Oryza sativa Japonica Group] >gi|34395084|dbj|BAC84770.1| putative 60S ribosomal protein L22 [Oryza sativa Japonica Group] >gi|113612149|dbj|BAF22527.1| Os07g0674200 [Oryza sativa (japonica cultivar-group)] >gi|125559577|gb|EAZ05113.1| hypothetical protein OsI_27305 [Oryza sativa Indica Group] >gi|125601487|gb|EAZ41063.1| hypothetical protein OsJ_024546 [Oryza sativa (japonica cultivar-group)] >gi|215764943|dbj|BAG86640.1| unnamed protein product [Oryza sativa Japonica Group]
Score 467
Evalue 3.74327e-45
Total Hit Count 262
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig1981
TTTGGAGGCAAAATATAAGGATTCTTCAAATTAAACCATTCATGTTCAACAGAGCACAACATAAGATAGGTGGATAACTAGGAGGTACTCAGATCAAGTA
TCAAAACTCAACAAGCACTACAATATAACAATGCACTCTAATCCTCCTCCTCGCCCTCGTTCTCAGCGATGTTGAAGTACCGGAGCTCGTACACGTTGCG
CTCCTTGTTGGCTGCGATCACACGAAGCCAGTCCCGCACGTTGTGCTTCTTCAAGTACTTCTTTGTCAAGTACTTGAGGTACCTCTTGGAGAAGGCGCCG
TCGGAGGTGACGGTGACCTTGCTCTTGTCGCGCGTGACGGTGACGGAGTCGCCGAGATTCCCGGCCTTGCCGCCGGCGACCTTGATGCGCTCCTGGAGGA
ACTTCTCCAGCGACGCGATCTCCATGATCTTGTCCTCCACGGGCTTGGTGCAGTCGATCACGAAGGAGACGGACCCCTTCTTCTTGCCCTTGGCAGCCGC
CGCCGCCGTCGCCGCCGTGCCGCGAGCCATCTCACCTTCCTCTTCCTCCTCGGCCGGTGCTCGCTCGGGTTGGGTGGGGGGTTCGTGTGGCGGCGCGC
page-top