Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig1980
Contig Information
Length 707 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 5 Clones [Download: CSV  ,  FASTA ]
whec10e06    rwhec10e06    rwhec10f15    rwhec18b13    rwhec18b19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 60S ribosomal protein L17-1 >gi|19102|emb|CAA44598.1| ribosomal protein L17-1 [Hordeum vulgare subsp. vulgare]
Score 867
Evalue 2.27231e-91
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig1980
TATTCCAAAACACAACCAGATTGAATCCAGTACATGAGACGATCATCAAAAGGTTTCACAAAGTATGAGCTAGCAGTATTTAGACGACAGATAATAGGCC
AAAAATTTCGACTCAGCCAGACCAGATGCTACAAACTGCTCTAACGAATAGGCAGATAGGTTATGTAGAGCTTCCTTCTCTAGGCCTTCCTGGCAATCTG
GGACTCAGCCTCCTTCTTCACCGGCTCTTCCTTCTCCGACAAGATCAGCTCAATGTGGCATGGGTTGGACATGTAGGGGTTGATGCGTCCATGGGCACGG
TAGGTCCGGCGCCGCTGCTTCTGGGCCTGGTTCACTTGGATGTGTGAAATGTAGAGAGCATCAACATCAAGACCTTTCACCTCAGCATTGCTCTCAGCAT
TCTTTAGAAGATCCAGAACGAACTTAGCAGACTTGGCAGGCCAGCGTCCCTGACCATTGGGCTGACGGTTCTTCACCTGGGCTGTGCGTCCAACACCACG
GCAGTACCTCCGGAAGGGGATGGCTTGCTTGTGTGCCAACACATCCTCAAGGTACCTCTTGGCCTTGTTGAGCGACATCTTCCTCAGGGCAAACGCTGTT
TCCCTAGTGTTCTTGAAATGAACACGCAGGTCCCGGCCCATGGCCTTGGCGGACTTGGTGGGATTGGCGGGATCCGTCGAGTACTTCACCATGGCTGCGG
CGGTGCA
page-top