Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig1941
Contig Information
Length 718 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 5 Clones [Download: CSV  ,  FASTA ]
whec9c01    whec17e15    rwhec10f16    rwhec9c01    rwhec17e15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_20483 [Oryza sativa Indica Group]
Score 618
Evalue 1.76221e-62
Total Hit Count 329
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig1941
TTTTTTTTTTAGCCAAACGATACGGATTTTTATTCAGTCGGCAACATCTTAGACAAACCATACTGATATGCCGGTACAGCAGCAGCATAATAATCAGGCG
ACAACACAACTTGCATCAAGCAAGACACAGTTCGACAAGCGGGCGGCAATATATATATGCCTTATGCCTTCAATATAGAGAAGAGCCGGCTGGCGGTTCG
AGCATTTATCGGAGGCGGCTTCGGCTTAGAAGCCGTGGATCTTGATGAGCTCCTTCTTCGCAATCCCAGCCTGGACTAGGAAAGTAGCAACATTCTTACG
CTGATCACCCTGAAGCTGAATGACCTGGCCTAGCTCCGGATCCTGGACTACTGTGCCATTGCAGCAGAATTCCTTCTTGAGATCCTTGAGGATCTTGTTG
TAGCTGAACTCCTTCTTCAGGCCCTGGACAGTGGTCAGACTCTTCCTGCCGTTGCGCTGCTGGATGCGCACATGCACATAATCTTTTGCGCCGGGGCCTG
CACCAGCATCCTCAGCATTTGCCTCAGCAAAAGGATCGAAGGCAGATGGCAGAGTAACGTCGAGATCAGACATGAAACTTTGTTGTTGAGGTTTGACTGG
CACCCAACAGATTAAGGTTTCTCTTGTTGGCCTTTATGTGGAAGCTTTTGCTGGCCGAGCGCACGCGACAGGAGAGGGAGGGGACGCGGTGCGGTGCGGT
GCGGTGCGAGAGAGAAAG
page-top