Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig1884
Contig Information
Length 695 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 4 Clones [Download: CSV  ,  FASTA ]
whec15b11    rwhec15b11    rwhec15o05    rwhec15o06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative cellulose synthase catalytic subunit [Hordeum vulgare]
Score 451
Evalue 1.81466e-61
Total Hit Count 301
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig1884
GCAGAAGAGTTGATGCAACAGCTGCCTTATATAAATAGTCGGTGTCACAGTGTGTATAAATACAATTCGGACATAATATACTCTAAGCAACAAAGAACAG
ATATCACAAATGGGGGAAAGGGGAGAAAAAAAATCACAATGTACGCTGCTGCAGGTTTCGTAGACAGTGGTTCTCAGCAGCATGGGCGGCTAACCAAAGG
GGCAACAATTAATTTAGATAAACTCCTCCCGTCTTCATCTACAACCAAAAAAATCCCATCTAACCCCCTCCGGTATTTACACGAGGGGGGCAGATACTCT
TGAGCGCCGATGATCCGATCAGCAGTTGACGCCGCACTGCCCCATGGCGACGGCCTTCTGGGTGTCGGATATGAACGGGTCGATCTTCACCCACAGGAGG
GAGAAGATGGAGGCGAGGAGGATGGACCAGACGATGACCGATGGTCGGCGTGCGGTTCTGCTTTCCCATGAGACCCTTGAGGAAGGGGTAGAGATGGAGG
ATCACCCAGATCGAGAAGAAGAGCTTTCCGAAGAGCGGGCCCCAGGATTGGTAGCCGCTGTTGATGGCGTATGATATGCCGGCCACCATGCCCACAAGGT
TGATGACCAGGACGGTGGTCGGAGGGATCAGGAGACTGGTCCACTTGAACACGTATAGCTCGGCGAAGTCGCCGTCCTCGTCGTTCGCCTTGGAT
page-top