Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig1881
Contig Information
Length 1085 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 4 Clones [Download: CSV  ,  FASTA ]
whec6m20    whec18f13    rwhec10d05    rwhec14l04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit chitinase IV precursor [Triticum aestivum]
Score 798
Evalue 4.81194e-83
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig1881
GAGCGGGACAGCTTGGCCATCCTTAACCTTATTTCGACATGGCGAGGTCGCCCATGGCGATGCTCCCGTTCCTGGTGCTCGGGGTAGCAGCACTAGTCCT
GTCTGCCGCGGGAATGGTGGCCGCGCAGAAGTGCGGCTGCCGGGCGAACGAGTGCTGCAGCCAGTACGGCTACTGCGGCACTACCGACGCCTACTGTGGA
CAAGGGTGTCAGTCTGGCCCGTGCTCGGGGAGCGGCGGCGGCGGCGGGACCGGCGCCTCCGTGGAGAGCGTCGTCACCGAGGCGTTCTTCAACGGGATCA
AGTCCCGGGCCGGCAACGGGTGCGCCGGCAAAAGCTTTTACACGCGCCGGTCGTTCCTGGCCGGCGCCCGGGCGAACCCCAACTTCGGGAAAGGCCGCAC
GGGCGACGACGGTAAGAGGGAGATAGCCGCCTTCTTCGCCCACGTCACACACGAGACCGGACACATGTGCTACATCGAGGAGATCGGCGGGGCGAGGCAG
AACTACTGCGACAGGAAGTACACGCAGTGGCCGTGCGCCTCGGGGAAGGGGTACTACGGGCGTGGGCCGCTGCAGCTGACGTGGAACTACAACTACGGGG
CGGCGGGGAAGAGCGTGGGGTTCGACGGGCTCAAAAACCCGGAGAAGGTGGCGCAGGACCCGGAGGTGGCCTTCAAGGCGGCGCTCTGGTTCTGGATGAA
CAACGTGAAGCAGGTCCTGCCGCGGGGATTCGGCGCGACGACCAGGGCGATCAACAGCGGCGAGTGCAACGGCGGGAACGCGGCCGCCATGAACGCCCGG
GCGGGCTACTACAGGGCCTACTGCAGGCAGTTCGGCGTCGACCCGGGGAGCAGCCTCACTTGCTAGGTGCTTTGCGCCTGATCGAGATGGGCATGCAGAG
AACATGCATGACTTATGTAGAATAAACGTTCGGCATGCGTATACGCGTCTTAAGCCGTCCAAACAAGAAATAAAGGGTGAGGATGTGGTCTAGCACGTAC
CAAGATCCTTGCAGTAGTACTGCTCACGAGCTCTACTCCTTTTCCTCATCAACAAGCAAAAAGTGTTACTCCCTATGTTCTTGTT
page-top