Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig1788
Contig Information
Length 1023 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 4 Clones [Download: CSV  ,  FASTA ]
whec10b02    whec10n15    rwhec10b02    rwhec10n15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 841
Evalue 4.54818e-88
Total Hit Count 125
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig1788
GGGTAATGGGAATCACCACAGAGTTTTGATCCAAGGGGAACAAACATGCAGTTCACTCCACCGGTCGCTCGGAACACTACCACGAGCCGACTTTGAAACC
TCTAGCACAACTACGACGAAGCTAGCATTACAGTACAGTAGATAAACACGCCGTGGTGGCCACAGCATAAGTTAACAGTGCCCACACAAGACGGTGGCCA
GATAACAGTTGGAAATTTCAGCGTAGCAGCAGCAGGGCATTGGGCTCACCCGCTCAAGCAAGACCTGAAGCAATTGAAGCTCAAGATAACCTCTGCTTCT
TCCTAGCAAGATTCTCGAAAATAGATTTTACATCATCAGATGTAACTGGTTTTGATGGATCAAAGGATTCCATAAAGGATTGAAACTCATTTTTCATGTC
ATTGATGCCACTCAGAATCTCTATCTTCTGAACATGGTTAAGTGAATTGATGAAGTTAGCTTCAGCTCCTTCCTGCTGCTCCAACTTCTTCTCCCTTTTC
TGCTTCGCTATCTTCTCATATTCCTCAATAGAGTCCTCCTTATCAGTAAGATGTGCAATGCCTCGTTGCGCATAGAAGTTGGTGCATGTCCCACATTTAC
ACAGGGTCTCTCTCCAGCCTTTTGACATGAAAAAGGGCATAGTTTTCTCTGAATCAGCTGATGTTGTATTTATATCCACTCCTATCTTACAGTTGCCACC
TGAATTGTCACCCAAAATGGACTTATCTGAAGCTGCAATGTCTTTTGTACAGTTCTCCTCGACAGAGGTATTTTCAATGCTTTGACGGTCTACAGGAGCA
CCGTTTTCATTTTTCTCAGTGTCAGCATGACCTGAAGAACCTCCTTCCATACCATTTGAATCAGCAGTAACAGCTTCTGATGCAGAACTCTGCTTACTAG
AAGCCCAGATCGTATCAGGATAGAGTTTCAAGAAATAACAAACAGGCGAGCATTGATGGCATATGAATTCTTCATACAGTGGCTCCCCTTCCTCATCTCT
TGGTATCTGCCATGCAAGGAAGT
page-top