Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig1786
Contig Information
Length 436 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 4 Clones [Download: CSV  ,  FASTA ]
whec10e09    whec17h22    rwhec8e03    rwhec17h22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195610892|gb|ACG27276.1| 40S ribosomal protein S25-1 [Zea mays] >gi|195636302|gb|ACG37619.1| 40S ribosomal protein S25-1 [Zea mays] >gi|195645218|gb|ACG42077.1| 40S ribosomal protein S25-1 [Zea mays]
Score 369
Evalue 4.83927e-34
Total Hit Count 293
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig1786
CAAGGGCAAGCAAAAGGAGAAGGTGAACAACGCGGTGCTGTTCGACCAGGCCACCTACGACAAGCTGCTCACCGAGGTGCCCAAGTACAAGCAGATCACG
CCCTCCGTCCTCTCCGAGCGCCTCAGGATCAACGGGTCTCTGGCACGCAGGGCTATCAAGGACCTGATGGAGAGGGGACTCATCAGGATGGTGTCAATCC
ACTCCAGCCAGCAGATCTTCACCAGGGCGACAAACACCTGATTTATCATTATCATGTGTTCTGGGTCTGTTTTTAGTCCAGTAGACTGAGGTGTTGCTGT
TACATTCAAGTTCACTATGTCCAGGGGGGCACACTGTGCCACCAGTAATGTTGAATTGCTTTTGAGTTTTGGTACACTTTAAGATCGTTTTGTCAGCGCA
ATGAAATCTACCTCATATATTGCCCTAAAAAAAAAA
page-top