Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig1762
Contig Information
Length 808 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 4 Clones [Download: CSV  ,  FASTA ]
whec10a02    whec10a13    rwhec10a02    rwhec10a13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_19723 [Oryza sativa Indica Group]
Score 526
Evalue 1.02351e-51
Total Hit Count 364
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig1762
AAGAGCTCATTCGACATTGCCTCAGGGTCTTTGCTAATACAGAGCAGCTCAAAGTTCACACACATGACCACCAAACGTTACAACTCATGTATTCCCATGT
AAACAAGGAAAAACTGACAGAATATCACAGGCTGGGCCCGGCTAGTTCGTCAGTTCCATGATAGCACTGACTATGTCACCGTCAGCAGATTTGAGCGCCT
TCACAGCCTTGGGCCTAGGCACACCGGCCTGGGTCATCACCAGTTCAATGTCCTTAGGCTCAACTCCAGTCTCATCACAATCCTCGTCATCCTCCTGAAC
AGCTGTAGAAGCCTCAGGGTTTGAGATGACGCTGCTAAGATCAGGCGCTTTGAATTGCTCGGCAGCCTGGGACTGCAGCTGTGAGCTCAGATCCTCAATC
TTAGCCTCACCGAAAATGACATAGGTGTCAGAGGCAGGGCTCTTGAATACATCTGGCTTGGAGATGACAAACAGGATATTCTTGCTCTTCTTGACAGTTA
CACGGCTCACGCCAGTGATAGTCTTCATGCCAAGCTTCAGCATGGCCTTCCTGCTCTTCTTCTCACTCCTACTCTGCTTAGATCTTCCACTTGCATCAAC
TCCCTCAACATCATCATCTTTGTCATCCTCGTCATCATCATCCTCATCTTCCTCATCATCATCATCCTCAACTACGGGCTCGTCTCCCTGCGCAGCGAGC
TTCTGCTCTTCCAGAACGGCGCGGAGCAGCTCCGCCTGCGTCGCGGTCTCGGCCGTCATGGTGGTTGGGTGGGCGGGTGGAGGCGCCGGCGCTGCTGGAG
AAACCCTA
page-top