Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig1758
Contig Information
Length 783 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 4 Clones [Download: CSV  ,  FASTA ]
whec6h13    rwhec10d02    rwhec6h13    rwhec7f08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit acetyl CoA synthetase [Deschampsia antarctica]
Score 889
Evalue 7.82632e-94
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig1758
TTTTTTTTTTCTTCGGCCAATCAATACATTCACGGAACTCTACGGATATGTGATACACAGGTTTACAAAAGTGAAACACAAGGAGAGAACATTACATTAC
ACCACGCTGCAGCTCACTAGCCTCAGGAGAAAATCGCACTGATTAAAAGGACTAGCGAGCACTAAAAGCAACCTTCTACCAACCACATAACCGCATAGGG
GAAAAAACAGTCGCATAACTGCTTTACATCCTAGCAATCTTTGAGCGCGATCAGCTGGTCGACGACGCCGGGGTCAGCGAGAGTGCTTATGTCGCCGAGC
TCGTCCAGCTGCTTCGCGGCGATTTTGCGCAGGATCCTGCGCATGATCTTGCCGCTGCGGGTCTTGGGGAGCCCCGGCGCCCAGTGGATCCTGTCTGGAG
CTGCAAACGCCCCGATCTGAGTGCGGACTTTTGCTATGAGGCTCTTTCGTAGTTCTTCACTGTAAGGAACGCCATCCACCAAAGTTACAAAAGCATATAT
TCCCTGACCTTTGACCTCATGCTCAACACCAACAACAGCGGCCTCTGCACACTGTGGATGCGAAACCAAAGCAGACTCAACCTCTGCTGTGCCAATTCGA
TGCCCACTAACGTTGATAACATCATCTACTCTTCCAGTAAGCCAGTGGTAACCATCTTTGTCCCTGCTGCAACCATCACCAGTAAAATAGTAGCCAGCAA
ATGGCTTGAAGTATGTGGTCTCATATCTGTCATGATCTCCATAGAGGGTCCGGAAAGCCCCAGGCCATGATTTTTTAATGCAA
page-top