Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig1754
Contig Information
Length 470 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 4 Clones [Download: CSV  ,  FASTA ]
whec12f01    whec12f02    rwhec12f01    rwhec12f02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein L15 [Homo sapiens]
Score 415
Evalue 2.27674e-39
Total Hit Count 362
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig1754
TTTTTTTTTTGAAAAGCATCATAACATTATAAGGTGAACGAGCAAACATATGACAGCATAGCACACAGCATACGATTACTAAACCATTCTTTCTTCTGGT
AACACAGGCAGATAGCAAATAGTTCAACAGATATGCCTCGACATAAAGGTTCTAGCACAAGCTTCAAGTAGTCTCAGAACGAAGGTAGCAAAACCTGATG
GCTCAAACAAAATACTATCAAGGTGTGCATAGGGCAGCTTAACGGTAGCGGCGGAGGGAGACGGTCTGGTTGCGCTTCCAGGTGGCTCTCCTTGAGGGCC
TGTTCTTGTGGTGGCGGTGGCCCTTGCCACGCAGACCACGGAATTTCTTTCCCGCCGACGTGAGTCCGCGAAGCTCACGGTGCTTGTGCACGGGCTTGCA
GAGCCAGTTGATCCTTGGGTCGTTGCGGACAGCACTGTGAGCAACATCAACAAGGATGACCTCAAAGTAC
page-top