Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig1670
Contig Information
Length 694 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 4 Clones [Download: CSV  ,  FASTA ]
whec10c02    whec9c02    rwhec9c02    rwhec9c08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os10g0508600 [Oryza sativa (japonica cultivar-group)] >gi|113639633|dbj|BAF26938.1| Os10g0508600 [Oryza sativa (japonica cultivar-group)]
Score 571
Evalue 4.59829e-57
Total Hit Count 20
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig1670
AAAATTCCCGACAAGTCAGAGAACAGAAGAGGGGCTAGAAACTCTTTAGAGGTCTACAGCATTCCATTCCAACGGGTATGAAAACTCGGTCGGTATTCCT
TTGTACTGATAGAGCACAGCTACAATTTCATGGCCTTCATGAAGTTCTCTTGGGAGGAGACATGTTTTGCAGGAGCCTGGTGGTTGTCGCGATGACCACC
AATTGGAGCAGGACACCAAGTGCAACACGGACCACATCGAACATTTCATAGCTTGTGATGTCTGCGGTGTTTTGCTTCGTGATCTTCACGAACAAGTCTG
AACGAATAATGCACGTCACAGAGAATGCAATAGCAATCGATGACAAGCTTGTGTACAACCGAAGAAACACTGCCACAGTCCGCCTCCGCCCAAATTCCCC
CAACAGAATGGCCAGCAGCCCGGCGGCCAAGGACAGCACGGCGAACTTGTTTATCTCCGTCCCCTTCGACAGAGACAGCAACAGCAACGCGCCCCCGGCA
ACTTGGTGCAGTGTCTGCACGAGCATGAGCCGGGCGAGGCGGGATCTGCCGTCGGCGACCCTCTGGTACCGGGAGTCGACGACCATGCGGTAGGAGAAGT
CGGAGCCATCCGTGCCGGACGGCCGGCCGCGCCGCTGCTGCATCGGGATGGACGACGACGACGGCGACGGCGGTGCCTCGTGCCGAATCCTGCA
page-top