Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig1619
Contig Information
Length 729 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 3 Clones [Download: CSV  ,  FASTA ]
whec8m17    rwhec8m17    rwhec13m01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit homeobox-like resistance [Triticum aestivum] >gi|167882868|gb|ACA06113.1| homeobox-like resistance protein [Triticum aestivum]
Score 816
Evalue 1.98859e-85
Total Hit Count 39
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig1619
AGACTTTGTACACACATCAGCAAACAAGTCGACATCGGCACATTACAGTTACCGGGCGACCATCCTTCCTCGACCGGAAGTTCCTAAGCAAACATTTTTT
TGGACTTAGTAAGTACACACCGAAGCGCACAGGGAAGCGAAACAACTACGCTCCCACGTTCATGTTGTCATCATGTGCTTCATTTGCAGCTTCAACTTTT
GGAATAACCTCCACATTCCCCATCTGCACATCTGAAACTGAATCACCGTGGGTGCCAGCAGGCGCAGCTGGTAAGGGAGCAGCCGGCTTGTCAGATGGCC
CTCCTTGATCTGGGTTGCGAACCACGGTCACCTCGGCAGTGTTCACATCCATCATCTTGTGCGCCTTTTGGGGTTTCTGCTCAACTGGGCTAACATTCTG
AGCATCCGCAGAGGCCGCCGCTCTAGATGCGTGCAAGATCTGGAGCCTGAAATCAGTTTCTGGTCGACGGCATACCTTCCTCAGAGGAACAATCTCCTCA
GAGTGATCATGATCATAACGAACAAGAAACCTGCAGCGGCACCCTCTTACATCATGCCTGCGCCTTTGAGCATCAAGAACACGAGCGTCAAAATAGAGGG
CCTGCTCTTTGCCTTCCTGAAAACAAAGAATGAGATCCCCAGGAAGCACAGCAACACATTCTGCAGATTCACATGGAAGAGAACGCAGCCTCACACATTT
ACGAACATTAATCCATTCATCCTCCTCGG
page-top