Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig1595
Contig Information
Length 900 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 3 Clones [Download: CSV  ,  FASTA ]
whec10b21    whec17h16    rwhec10b21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0158600 [Oryza sativa (japonica cultivar-group)] >gi|55296600|dbj|BAD69198.1| unknown protein [Oryza sativa Japonica Group] >gi|113594907|dbj|BAF18781.1| Os06g0158600 [Oryza sativa (japonica cultivar-group)] >gi|215715283|dbj|BAG95034.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765556|dbj|BAG87253.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218197628|gb|EEC80055.1| hypothetical protein OsI_21758 [Oryza sativa Indica Group]
Score 939
Evalue 1.5918e-99
Total Hit Count 313
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig1595
CCGCAGCCGGTGGTAGGGCGTCGAGTCGAGGGAGGATGGGGAAGTCGAAGAGCAAGGGCGCCAAGTTCGCCGCCGTCAAGAAGATCATCAGCAAGAAGAC
CATCCAGAAGTACAAGGAAGATGTGCTGGACCCGCGGAAGAAGGACACCGAGAAGGAGAAGCTCGGCCGGAATGTGCCGCAGGTGTCGTCGGCGCTCTTC
TTCAGCTACAACATGGCGCTCGGGCCGCCCTACCGGGTCATCGTCGACACCAACTTCATCAATTTCTCCATCCAGAACAAGTTGGATTTGGAGAAAGGAA
TGATGGATTGCCTTTATGCAAAATGTACCCCTTGCATCACTGATTGTGTTATGGCTGAGCTTGAAAAGTTAGGACAAAAATATCGTGTGGCTTTGAGAAT
TGCTAAGGACCCTAGGTTCCAGAGATTAGCGTGCACACACAAGGGAACTTATGCTGATGACTGTATTGTTGAGAGAATTACTCAGCACAAATGCTACATT
GTTGCCACCTGCGATAGAGATTTAAAGAGGAGAATAAGAAAGGTTCCTGGTGTGCCAATCATGTATATCACCCAACACAGGTACTCGATAGAACGACTCC
CTGAAGCTACAATTGGTGGAGCACCAAGAATCTGATTAGCCCTGAGATGGTACCAAACACCATCACACTTGCCCAGGTTCCTTGATTTAGGATGGATACG
AGTACTGCCGCGCTGAATCGAACTGATTGTAACCACTTCAAAATTGTGTACCAGCCTCCTCAGGGCGTCGTTTTCATAAATTTTGAAAGAAACTTTAGAA
GAAAGTGTATGGTTGTCCTTTGTTCTGAACTGAACTATAGCCAACTTCCCAGCTTGCTTTGTGTTGTTAATGATGCAGAGTCAAGAATATATTTTATGTA
page-top