Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig1588
Contig Information
Length 734 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 3 Clones [Download: CSV  ,  FASTA ]
whec3k23    rwhec10e09    rwhec3k23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_04485 [Oryza sativa Indica Group]
Score 740
Evalue 1.31524e-76
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig1588
TTTTTGAGTCTGTTTATGAAGCAGGGCAGTTCATCTAACAAGCAGTTTGAATTCCAATGAACAGCGTCAACACGGTAAATCATGTTAAGAACACGTCACA
GAAGTACTTGAATGTAGGGGAAAGCGGTGAAACTTTTACTTTGAAACAGCAGAACTACCAACATATATAGCACGTTTTAATACCCACGAGCAGACCACCA
AATGTCCATCCAGGACTGAATCAGCTTAACCAAAACCTTGGGATTCCAGAGTCGCGCTCAGCCGCAGTACTATTGTTGGGCAGTCTCTGTATTCTGTTTG
AGAACTCGTTTGCCTTCTCATCAATCCACATTAGAGAGCGCAGTTGATTATCCAGTATTCGGACAGCAACATCAAATGGTGCCATGGTATCCGTAGCCTC
AAGCTCACCACCCTGAGTAGAATTCATGGTCTGAATGATGGATTTCACTTGTTCTGTCATATGCTGCAACTCATTCTCCACAACTTCAGCTTGCTCGTAC
ATTATATCCCTTGCCGAGGCAGCCTCATCTTCACGAAGTAAGACCCGTTCATCCTGGAATATACGCTCGGCTTCCTCCTCCATGCTCTGCAGAGCCTTGT
CCACCTCTTTCTGATGAGTTTCTATCAACTCAAGTTGCCTCTCCAAGCTTGTTTGTGTTTCAACAACTTTGGCCACATCAGCCTCAAGCCTTATAAGAAC
ATTCCTGTTTTGCAGAATTCTCCTGTCCCATTCA
page-top