Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig1561
Contig Information
Length 1194 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 3 Clones [Download: CSV  ,  FASTA ]
whec10b17    whec8c19    rwhec8c19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit fructan exohydrolase [Triticum aestivum]
Score 1591
Evalue 6.18134e-175
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig1561
AGATGGTTGGCGACAAGCTGCTGGTTTCTACAGTACTGTTGCATGCACATACATTCTTACTTGAACTTTGTGGCATGCACAAGCTCATACTGTTTATTCC
AAACCTCTGCGAATTTAAATCGTTGTTGGCAACAAGCACTACGCTTACTTACCAATTGCCACTACTTCAAAAGTTCAAATACACGTGTTAAATATTGAAA
TCAACAAGTGCGTGGCCAGTCTTTCAATCACACGTCTGACTAGAACTGCTCTTCTGTGCTAAGCATCGATCACATTTCCACCCTTCATCACATTCACCTG
TGCTCTCTTCATGCTCCATGCCCTTAGCTGTGGCACTCTGACCGTGGTACTTCCATTGTTGAATGCATACATGTGGGTGGTGCCGTCGTCGACAAGTGCC
ACCGGGTAAACTCTGGCCGTGATGCAGATCCTGCCACCGCTGCCGAAGCTCTCCACCGCGGACCGATCGATCAGAGTCCTGAGGGATATCTTTCTTTCAT
TTTCAAGGTCAAATTCAAAGAAGCCTCCATAGGCTGGTGTATACAGTCCTGGTCTCAGGGAAGACCTTCTTAGATCAGAGCACATGAGGATCATGTACTT
TTCCTGTGATTTGTAAACCCTGAAGTGCACTGCAGTGTGCTCCTCCATGTTGTCGGACGCCAGAATAACAAGTCCAAATGGCCCTATGCCACCATGAGCC
GATGCATCCGCCTCCCGGCAATGCTTCCGGGGGTCGAAAAGCCAGGAAGGATCAAAAGGTTCGGCGTCATCGATGGACGTCGGCTCAAAATCTATCTCAA
CGTCAGCCTGCAAAGTGTCGATTCCCTTAATCTCAAATAGATCTCCCTTTTTCAGCTCTAGTCCTTGATGGTTGATTTCATTTATTCGAAGGGACTCAAT
CTCTTCAACTGGCCATTGGATCAACTGCTTGCCATCGCCGTCTAACCAAATTGTCCTGGGGATTGAATGGATTCCTGCCCAGCCTTTTGCAATATCATCT
GAATAACTATCTGTCTCGTTACTCCAAGCCCATATGACTCTCCTGCCATGTTTGGAGTCAAAGAATGATTTTGAAGCATAGAAAGTACCATAATCGATCC
TCGTCCACAGCCGATTGTCATCTTGGACGGTGTCTGGCACAAACTCATCACGTTTGAGATCATACACCCCAACTATGTACATGTCACCAGGAAT
page-top