Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig12
Contig Information
Length 912 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl1e23    rwhfl1e23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0707300 [Oryza sativa (japonica cultivar-group)] >gi|19571103|dbj|BAB86528.1| vesicle transport v-SNARE (vesicle soluble NSF attachment protein receptor) protein-like [Oryza sativa Japonica Group] >gi|20804648|dbj|BAB92337.1| vesicle transport v-SNARE (vesicle soluble NSF attachment protein receptor) protein-like [Oryza sativa Japonica Group] >gi|113533552|dbj|BAF05935.1| Os01g0707300 [Oryza sativa (japonica cultivar-group)] >gi|215737574|dbj|BAG96704.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765545|dbj|BAG87242.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218188933|gb|EEC71360.1| hypothetical protein OsI_03452 [Oryza sativa Indica Group]
Score 867
Evalue 3.64056e-91
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig12
gaccgccgtccccccctccccaacgaactcgctccgaccacccacccacccatcgactgcctcggctccgccggaggctccgcgggcctcgatccggtcc
ggctgccgcgaccgccggcggattcaccggggagggagcgaccatgagcgacgtcttcgagggctacgcggggcagtactgcgagatctccgccgccctc
tcccgcaagtgcgccgccgcctccgccctcgacggcgagaAGAAGAAGCAGAAGCTGTCCGAGATCCAGGCCGACGTGCAGGAGTCTGAATCGCTGATCA
GGAGGATGGATTTGGAGGCGCGGAGCATGCAGCCGAGCGTCAAGGCCGGGCTGCTGGCTAAACTGAGGGAGTACAAGTCTGATCTCAACAGCGTCAAGGG
CGAGATCAAGAGGCTCTCCGCGCCTAATGCCCAGCAGGCCACCCGGGAGGAGCTCCTCGAGTCCGGCATGTCCGACACACTCGCGGCATCATCTGATCAG
agaggaagattgatgatgacatcagaaaggttaaaccagtcttcagacagaattagagaaagccaaagaacagtatttgagacagaagaaattggcgtgt
caattcttcaggaccttcataatcaacgacagtcactgctgcatgctcacacaacattgcatggtgtggacgactacatcggcaaaagcaagaagatcct
ggcttccatgtccaagaggatggacaggaacaagtggatcgtcggcagcatcattgcgaccctcgtcttcgccatcctcttcatattgtacttcaagttt
gcttaaccattccaaatgcagcatgtgcctgaattcagaatgtttgtgtttgtggaacatgatgtatagtgacacttgccagttgccatgtaaaacacaa
aatattgaaaga
page-top