Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig1436
Contig Information
Length 1114 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 3 Clones [Download: CSV  ,  FASTA ]
whec10b03    whec10k14    rwhec10b03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit polyprotein [Sorghum bicolor]
Score 288
Evalue 6.90375e-24
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig1436
CACAATAAAGAACAAGTATCCGCTCCCCAGGATCAACGACCTATATGATCAGCTCGCTGGATCCTCAGTCTTCTCTAAGATGGATTTGAGGTTGGGCTAC
CATTAAATCAAAATCAAGAATGGGGACATCTCTAAAACGGCCTTTGTTACTCGTCATGGCCAATACGAGTACACTGTCATGTCCTTCGGTTTAACCAATG
CCCCAACCACTTTCTCTCATGTTCACGTGTTACTAATCAGTAGTACCTTATATGATTGATGGATACAAGCCTAGTTCAGTTCTACTACCCCATTATGTTG
CTAAAATGGATTCAGAATCTTGATATGATGTTGTTAGTGTCTATGCAATCCTTTGCAAAGTGTCTCAAAATCTTGATATGATGTTGTTGAGTGTCTATTC
AATGATGACTATTATGCGGGCTAGAACTGGCTTGCTTTGGAACACTGACTTCCGCTATATGCCAGCGTCACTCCCTGGGGCAGAAGGTTATTTCACAGCT
ATTTACACCGACTCTCATCATGAGGACTCGCTACTTCGCACTACCGCACAGATGCTTGAGGATAAGGACCGTGAAAATCGTGCCTTGCGATTGGAGCTTT
TCAACTCCCGGTCTGATCACTGGGACACTTTGACCCGGTTTGCACCTGCTGTGCAGGCTGGGTATATGGATATGCGGGATCTGTACCCCGTGCGGTCTAG
TCTGCTGGATCATATGGATTGTCGTGATGTAGGGGGCATCACTCCTCCCCATGGACCTCTTCTGTCACCATTTGTTGGTCCCAGGCCACATCTGTGTCCC
TATGGACTGCAGGCTCCACAGGATCGACTGTTTCCAGATGATCACGTCCAGCTTCCAGGACATGGGGGTAATCTCTACGAAGATTACTACGGAGATGTTT
GAGCTGATGGTAGCACCACTAGTATTGTAACAGTTATATCGTCCACCGTCCTGCGTGATTGTGGGATATGACTGAGCTGATGGTACCACTTTTNGGAGGT
GTAGAAATATAATGTATAGGAGCTTGGGATGCCTCCGATAAGATGTAATCTTCCTTTCATCGCAGTTGTACTTCGTTTGGTCTTGTACTAAACCTTGTAT
GGTGTGTATGACGA
page-top