Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig1431
Contig Information
Length 858 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 3 Clones [Download: CSV  ,  FASTA ]
whec10e13    rwhec10e13    rwhec14e02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit carbohydrate-selective porin [Zymomonas mobilis subsp. mobilis ZM4] >gi|56542534|gb|AAV88688.1| carbohydrate-selective porin [Zymomonas mobilis subsp. mobilis ZM4]
Score 90
Evalue 0.412558
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig1431
GAGCACATATATGTTTCTAGGTGTGCCACACAATAAAAAATGAAGTGGTGCCACAAAGGGAGGAGTACATATGTTTCTAGGTGCGTCACCCAACCAGAAA
AGAGCATACAGTGGCTTATGTGCCAAAACAACCACCAAAATGAGCAGCACGTGCCAATGTCACCAGGTTCAACAAACAAGGTACATTACATAACCACTCC
ACCAACTTAATTGTAGGTCTTGCAAACATTCAACAGCTTGTAGGTGATCCAAGCCTTAACTTGTAGATCATCCAAACCTTCAGAAGCTTGTAGATCACCC
AACTTAATTGTAGGTCTTGCAAACATTCAACGGCTTGTAGGTGATCCAAGCCTTAACTTGTAGATCATCCAAACCTTCAGAAGCTTGTAGATCACCCAGT
GTATCTTTGGGAAACAAAGTGTATTCTCTGCATTCACAGAAAAAAGTGTATTCCCTGCCTCCATTCAAACTTCTCCTCCGAGCATGTTGTAGCCTTTGCT
TAGCTGCTAGTGACTACTTGTCATGTCATAATACATGGAACATATAAGAATCAGTGCTTCATGTTATTCTTATGAAATAGTAACTTATATTGAGTAAAAA
CTAGATTGGAGATAAAGGAACCGTAGAAAACCAACATATTATACTACCTCCGTCTCATAATGTAAGACGTTTTTTGACAATACTTACATTATGGGACAGA
GGGAGTACCATTTAAACTCTAGAAGAGTGGTCCACTTTCAGTCTGTCTTGCAGCAAAATGAAAGGAGGCGTAAACAAGTTCTCTAGCTAGTTGTTTTCTT
CCATGTAGTAGTATATGTGTGTGATGACAGTTGAACTAGATGATCTCACATCGATCAA
page-top