Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig1419
Contig Information
Length 1019 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 3 Clones [Download: CSV  ,  FASTA ]
whec10a09    whec15n24    rwhec10a09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0679200 [Oryza sativa (japonica cultivar-group)] >gi|33146440|dbj|BAC79548.1| unknown protein [Oryza sativa Japonica Group] >gi|50509522|dbj|BAD31215.1| unknown protein [Oryza sativa Japonica Group] >gi|113612174|dbj|BAF22552.1| Os07g0679200 [Oryza sativa (japonica cultivar-group)] >gi|215741246|dbj|BAG97741.1| unnamed protein product [Oryza sativa Japonica Group]
Score 135
Evalue 4.12658e-09
Total Hit Count 42
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig1419
AAGAATCGATGCCTGCCGCCACAATCGGCCATGAGAACACCGGCTGCTATATCCTCGCCGCCCTCTACCGCTCGCGCCACGGGCGTCGATCCAGCCGGGG
CGCAGTCGCGGCTGGTGGTGCCATCGTCGTCCGGCAGGACCATCCCCGAGCGCCTCCCATCAAAGGATCCAGCGTCCATGTCTGGTGTCGGGCCCCCTGC
TATGGCGGCCTCGAGTGCTTGGTGCCGGTGGTGTCGTCGAGCCAAGCGCGCTGGAGCGCGGCAACGATGGCACGGTGGTGCTCGGCGGAGTTGAGGGCAA
GCTAGCGCGCGAGCAGCTCCTCGAGGCCCCGTGATAATCTCCGCCATGCTCTTCAGGAAGTCCTCCTTCGAGTCCCTCGGCTCCTTCACCACAACGAGGC
TCTCCTGCAGCCAGCACCGCCGCCTCTGCCGCATGGTGGTCACCACCGGGGGCTGCACGTCCGCTGGCCTTCTCCCCTTCAGCTCGCTGCTCGGCTTCAC
GTATGGTTCGCCGTCGCTGCCTCGCCCTGGCCATCGGTCGCTGGCTGAGGTCTCCTCCTCCCTGTCGACCTTCTTTGCGGTGCTTGGCTCTTGGGGTCCC
CTTGGCGGGGCCATCAGATCGGGACGTAGTAAGATGCCCTGTTTGGGGAATGTGGCAGCGGCACCCCCTGCTGCCACGACGGTTGATGGCGTCACCACCG
CCGGAGCACGATCACTTATGTGGTGCTCCCTTAGGAGCCCGGCGGTTGCATCATACGGCACTGCGGCGAGAGGGTGTTACACTTCTTACTCTAGCTGGAT
TTCCTTTCTCTGCTTGCGTTGCACTTGCTGTACAGTAGGGAGCGTGGCTGGGGCAGAATGTGGAGTGAGCCGTTGTGCCATGCATACGCGTGCACTTTTA
GTGCGGAAGTTTGCCGCACGTAGCAGTCGACGTCGCGGCCCACCAAGACTGAGGCATGCTGAATACTGTCGAGCACAAGATGAACATGTACAACTCTGAA
TCCTTTTGCTACATTGACC
page-top