Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig1388
Contig Information
Length 1038 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 3 Clones [Download: CSV  ,  FASTA ]
whec5a21    whec5g16    whec13m24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cytosolic heat shock protein 90 [Hordeum vulgare]
Score 1332
Evalue 5.38913e-145
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig1388
TTCTCCTCCGCCTCGAGCAGCTCATGGACGCGCGCAGCCATGGCGACGGAGACCGAGACCTTCGCCTTCCAGGCCGAGATCAACCAGCTCCTCTCGCTCA
TCATCAACACCTTCTACTCCAACAAGGAGATCTTCCTCCGCGAGCTCATCTCCAACTCCTCCGATGCCTTGGACAAGATCANGTTCGAGAGCCTCACGGA
CAAGAGCAAGCTCGATGCGCAGCCCGAGCTCTTCATCCACATCATCCCCGACAAGGCGACCAGCACGCTCACGATCGTCGACAGCGGCATTGGCATGACC
AAGTCGGACCTCGTCAACAACCTCGGGACCATCGCCAGGTCGGGGACCAAGGAGTTCATGGAGGCACTCGCTGCCGGCGCTGACGTGTCCATGATTGGGC
AGTTCGGTGTTGGGTTCTACTCCGCCTACCTCGTCGCCGAGAGGGTCGTCGTCACCACCAAGCACAACGACGACGAGCAGTACGTGTGGGAGTCTCAGGC
CGGTGGCTCCTTCACCGTCACTCGTGATACGTCTGGGGAGCAGCTCGGCAGGGGTACCAAGATGGTGCTCTACCTCAAGGACGACCAGATGGAATACCTT
GAGGAGCGCCGCATCAAGGATCTAGTTAAGAAGCACTCTGAGTTTATCAGCTACCCCATCTCCCTGTGGACCGAGAAGACCACTGAGAAGGAAATTTCTG
ACGATGAAGATGAGGAGGAGAAGAAGGATACTGAGGAGGGCAAGGTTGAGGATGTTGATGAGGAGAAGGAAGAGAAGGAAAAGAAGAAAAAGAAGATCAA
GGAAGTCTCTCATGAGTGGAACTTGGTCAACAAGCAGAAGCCTATCTGGATGAGGAAGCCAGAGGAGATCAACAAGGAAGAGTATGCTGCTTTCTACAAG
AGCTTGACCAATGACTGGGAGGAGCATTTGGCTGTCAAGCACTTCTCTGTTGAGGGCCAGCTTGAGTTTAAGGCTGTCCTGTTTGTGCCCAANANGGCCC
CCTTTGACCTCTTCNACAACAANAANAAGGCCAACAAC
page-top