Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig1339
Contig Information
Length 456 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec10a01    rwhec10a01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative proteinase inhibitor [Hordeum vulgare subsp. vulgare]
Score 300
Evalue 4.85809e-26
Total Hit Count 224
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig1339
TCAAGGTCCATTTAGCTGCTCACGGAAGCGAGGATGAGCTGTGCCGCCCCCGGAGAGGAGAAGAAGACGTCATGGCCTGAGGTAGTGGGAAAGTCCATCG
AGGAGGCCAAGGAGATCATCCTTAAGGACATGCCTGACGCCGACATCGATGTCCTTCCTGCTGGCTCGGCGATGACCCTCGACTTCAGGACCAACCGTGT
CCGCATCATCGTTGACACTGTCGCGACCACCCCTTCCATTGGTTAGCAAGCTTTGCGAGCGAGAGACAAATTGGATGCACTTATGCATGCGGATGAATAA
GTAGTTTCAATAATCATGAATGAATAAATACACGCTGACCAATGGCGTGTGTCGATGTACTTATGGTTCAATGGACTCCAGTTATTTTAATTTATGAGAT
GTCGGCTCGTTGTCCATGTGTTTACTAAAATGCTCATGAAATATGCAAAAAAAAAA
page-top