Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig1285
Contig Information
Length 737 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec10d02    whec7f08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0525900 [Oryza sativa (japonica cultivar-group)] >gi|49388280|dbj|BAD25398.1| putative acetyl-CoA synthetase [Oryza sativa Japonica Group] >gi|49388286|dbj|BAD25401.1| putative acetyl-CoA synthetase [Oryza sativa Japonica Group] >gi|113536526|dbj|BAF08909.1| Os02g0525900 [Oryza sativa (japonica cultivar-group)] >gi|125582341|gb|EAZ23272.1| hypothetical protein OsJ_006755 [Oryza sativa (japonica cultivar-group)] >gi|215694616|dbj|BAG89807.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1162
Evalue 1.54573e-125
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig1285
GAACTCGTCTTCCCCAGCGCCGAGTTCTCCGCCACCGCGCTCGTCTCCTCCCCCCAGCAGTACAAGGAGATGTACGAGAGGTCCATCAAGGACCCGGCCG
GGTTCTGGTCAGAGATCGCCGACGCCTTCTACTGGAAGGAGAAGTGGAACCCCAACGAGGTCTGCTCCGAAAACCTCGACGTCAGCAAGGGCCCCGTCCA
CATCAGTTGGTTCAAAGGGGGCAAAACCAACATATGCTACAATGCCGTCGACCGCAACGTCGAGGCTGGGAATGGGGACAAGATTGCACTGTACTGGGAG
GGCAATGAGCCCGGCCAGGATGGGAAGCTCACCTATTCTGAGCTCGTGGAGAAGGTTTGCCAGCTTGCAAATTACTTGAAAAGTGTTGGTGTCGGCAAGG
GGGATGCTGTGATCATCTACTTACCGATGCTGCTGGAGCTTCCCATTGCCATGCTTGCATGTGCGCGTATCGGTGCTGTCCATTCGGTTGTGTTTGCTGG
CTTCTCTGCGGATTCGCTGGCCCAAAGGATCGTTGATTGCAAGCCTAAGCTTGTGCTCACTTGCAATGCCGTGAAAAGGGGGCCCAAGCCCATTCTTCTC
AAAGATATAGTGGATGCTGCTCTGGTGGAAAGTGAGAAGAATGGATTCTCTGTAGGTATTTGTTTGACATACCAAAACCAGACANTAATGAAGANGCAAG
ACACAAAATGGCAAGCGGNAAGGGATGTTTGNTGGCA
page-top