Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig1281
Contig Information
Length 815 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec10e22    rwhec10e22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit pollen-specific protein SF3 [Zea mays] >gi|195645500|gb|ACG42218.1| pollen-specific protein SF3 [Zea mays] >gi|195654645|gb|ACG46790.1| pollen-specific protein SF3 [Zea mays] >gi|195656225|gb|ACG47580.1| pollen-specific protein SF3 [Zea mays] >gi|219887333|gb|ACL54041.1| unknown [Zea mays]
Score 964
Evalue 1.68822e-102
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig1281
AGCAGCTCGGCTTGCAGATCGAGAGTGAGGGAGTGAGAGGCAATGGCGACTTCGTTCCAGGGGACGACCACCAAGTGCAACGCCTGCGACAAGACGGTGT
ACCTCGTCGACAAGCTCACCGCCGACAACCGGGTCTACCACAAGGCCTGCTTCANGTGCCACCACTGCAAGGGCACCCTCAAGCTCGCGAATTACAACTC
GTTCGAAGGAGTGCTCTACTGCAGGCCTCACTTTGACCAGCTCTTCAAGAGGACCGGGAGCCTCGACAAGAGCTTCGAAGGCACTCCAAAGGTTGTCAAG
CCGGAAAGGAATGTTGGGAATGAGAATGCTATTAAAGTCTCGAGCGCATTTGCTGGCACCAGAGAGAAATGTTTTGGATGCACCAAGACAGTCTATCCAA
TTGAGAGGGTTACTGTGAACAACACCATGTACCACAAGAGCTGCTTCAAATGCTGCCATGGAGGGTGCACCATCAGCCCTTCGAATTACATCGCGCATGA
GGGCAAGCTCTTCTGCAAGCACCACCACACCCAGCTGATCAAAGAGAAGGGCAATTTCAGCCAGCTCGAGAACGATCACGACAAAGACGTCACAGAAGTG
CCGGGTCAGTGGATGATGAAGACTCGGAGTATTAGTCAGTCCTTGAGGATATCCAGAGATGAATAACGAGCCCTTTTGCATTTGCACCAGAGCAGTATGT
CTTTCTGCTGTGTGGTTCTTTTGAGTTTTTCCAATCGAGATCAAGTGCATTCCAAAGACAATTATGTTATTGCCTTGTACGCATGTAAACCCTTGTTATA
TCCCGAGTCAAAATT
page-top