Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig1280
Contig Information
Length 340 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec10f08    rwhec10f08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0633400 [Oryza sativa (japonica cultivar-group)] >gi|49388178|dbj|BAD25304.1| putative replication protein A2 [Oryza sativa Japonica Group] >gi|113537041|dbj|BAF09424.1| Os02g0633400 [Oryza sativa (japonica cultivar-group)] >gi|215707148|dbj|BAG93608.1| unnamed protein product [Oryza sativa Japonica Group] (no hit)
Score 614
Evalue 7.86353e-62
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig1280
GCAGCAAGCAGACACCGAGAAGTTCGATACCCAGTCCGCCTGCTGCGCCGCCACCTCCGCGATGAGGGCCAAGTGGAAGAAGAAGAGGATGAGGAGGCTC
AAGAGGAAGCGCCGAAAGATGAGGCAGCGATCCAAGTAGGTGAACAACGAGGAGAAAGCTGAACCTTGTATCATTGCACCAGTATGTTGGGATGATAGGG
TGTTCTGGTTCCTGATATGTCTGGGTTGTTGTGATATTTGGGTGATGCCAACCCTTGTAACATGAGGATAATTATATGCTTTCCATCGAGGCTGGATATT
CAGCTTAAGAAATATTATCATCTATTTTTGAAAAAAAAAA
page-top