Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig1276
Contig Information
Length 490 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec10f14    rwhec10f14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit predicted protein [Phaeodactylum tricornutum CCAP 1055/1] >gi|217407641|gb|EEC47577.1| predicted protein [Phaeodactylum tricornutum CCAP 1055/1]
Score 82
Evalue 0.938526
Total Hit Count 6
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig1276
GGACAGAATCTGATGGATCGGGGGTCAGAGATTGCGGGGCAGCTGAAAAAGCATGCCCCGGAAATCTTGGGCAGCATCTGCAATGAGGCTATCTTCCAGA
TGAAGATACCATTCATCGGCAGCAAAGAAAGCCAGTTCGAGTTGAAGGACTACTGGTTTAACGACCCCAACAAGTCACTAAGCAGGCTAGAGCAGAGGGC
GAGGCGTGCGTTGGCCATGCGAGAGAAGGACCGGATTCGACGTGAGGAGTTCAAACGTGCTGAGGCGGAAAGGAAACGTGCGGCTGCGCCTCTGTACGAT
GCAGTACATGGCCAGGAAGGATTTGAATGGTATGAAGGTGATGGATGCAGCTATCGCGAGGAGAGGATGAGGCGGTTGTCGGGGAATATGTAGGACAGGA
CACGTAGACAGCAGCCGGTCTGATAAGCTGTGCGGTCGTGGGTGATGGACCCGGTTTTGACACTGTTGGCAATTGCTGCCAAAAAAAAAA
page-top