Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig1177
Contig Information
Length 738 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 6 Clones [Download: CSV  ,  FASTA ]
whfl19l03    whfl4d07    whfl10b20    whfl19l04    whfl16d04    whfl25l21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=T-complex protein 1 subunit epsilon; Short=TCP-1-epsilon; AltName: Full=CCT-epsilon; AltName: Full=TCP-K36 >gi|435175|emb|CAA53397.1| t complex polypeptide 1 [Avena sativa]
Score 564
Evalue 9.3781e-98
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig1177
ctCCCTCCAGAAACCTACCGCCGCCTCATTCTCCCCCCACCACAGCACCCCTCCCAGTCCTCGTCCGATCCGCCCTTCCGGAGGTTTCTGGGAGAAGCGG
CGCCAGCGCTCCGGCGGCCATGGCGCTCGCCTTCGACGAGTACGGGCGGCCCTTCATCATCCTCCGGGAGCAGGAGAAGAAGTCGCGGCTGCAGGGGCTC
GACGCGCAGAAGGCCAACATCGCCGCCGGCAAGTCCGTAGCGCGCATCCTCCGCACCTCCCTCGGGCCCAAGGGCATGGACAAGATGCTCCAGTCCCCCG
ACGGCGACGTCACCATCACAAACGATGGGGCGACGATCCTGGAGCTAATGGATGTTGACAACCAGATTGCGAAGCTCAT*GGGTGGAGTT*GTCCCGCAG
TCAAGACTATGACATTGGAGATGGTACCACCGGGGTTGTGGTCCTGGCTGGGTCGCTTCTGGAGCAGGCTGAGAAGCTGCTGGAACGTGGTATTCACCCA
ATAAGGATTGCCGAAGGTTATGAGATGGCGTCGAGGATAGCTGTTGATCACCTTGAAAGCATCTCCACGAAATATGAGTTCAGTGCTACAGACATAGAGC
CTTTGGTGCAGACCTGCATGACAACTTTGTCCTCAAAGATTGTTAGCCGTTGTAAGCGGGATCTAGCTGAGATTGCTGTCAAAGCAGTCCTTGCGGTTGC
TGATTTGGAAaggaaagatgtaaatttggacttgatta
page-top