Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig1156
Contig Information
Length 586 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 6 Clones [Download: CSV  ,  FASTA ]
whfl10h11    whfl29l19    whfl46i10    whfl14p19    whfl11p20    whfl30l19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit NAD-dependent dyhydrogenase, Gfo/Idh/MocA family [Zea mays]
Score 728
Evalue 1.94782e-75
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig1156
ggaAGCAAACCATACTCCAAAAGAATGGCGGGGGACGGCGAGCTTCTTCCCCGGATCGCGGTGGTCGGCGCGGGCATCTTCGCGCGCACGCAGTACATCC
CCAGGCTCCGCGAGATCTCCCACCTCGTCGTCCTCAAGGCCATCTGGAGCCGCACCCAGGAATCCGCAGAGGCTGCCGCGGAGCTCGCCCGCGATTTTGC
GCCTGGCATCGAGTGTAAATGGGGCGACGCGGGGCTGGAGGAGATCATGGGAGACCCTTCCATCCTCGGCGTTGCCGTTGTTCTTGCAGGCCAAGTCCAG
GTTGAGCTTTCCTTGAAGATGCTCAAGGCAGGGAAGCATGTGATTCAAGAGAAACCTGCCTCTGGATCGTCAACTGAAGCAGAAACTGCACTATCAGTGT
ACAACTCATTTCCAAACAAGCTCCCCTGTAAACCAATTTGGGCTGTTGGAGAGAACTACAGATTTGAACCTGCATTTGTGGAGTCAAGCAAGTTGATGGA
CGATATTGGTGATATGATGAACATCcaagttattgttgaaggatcaatgaacagttcaaacccatatttcaatagctcctggagac
page-top