Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig1051
Contig Information
Length 1244 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec10b11    rwhec10b11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_10231 [Oryza sativa Indica Group]
Score 73
Evalue 0.0086515
Total Hit Count 9
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig1051
GTTTGGCGCAGTTTGTTATGCAAGTGCAGCAGACTCGAGAATGGTTTAGGGAACTTGGTATTAGTCCGCTCTTGATATATTTAGCCTTTTATACTGACTT
CTGTTCTAATATATCACATGTGCAAGTGAATGTTTGCCAACTTCAACCAAGTGGATATTTAGGGTCTTGATCTTAAATGATTTTCCTTTTCCTTGTGGCA
ATATGCAAATGTGTTAGTTTAATATGCAATATCACTATGATCGGGTCAAGTATAATATCTTTTGATTTCCCCCTTCATTTGTGTCCGATAGAAATGTTAA
GCAAGTACTGCCCTTGAAGCATTATTTCCTGCTGCTGCACATATACGTTCTTACAAAGTTGTGACTGTCATGACTAGAAGATTCACGTCTATGTGGTGCT
TTGCAGATCTATTCTTAGATTGTGACTTGCCAACTTACAAGGAATCCAAAGCACTGCTTACCGAGTGTTGCCCAGTATCCTCTTTGTGTGTACATATTCA
TGCGCTACTGAAATATGCTACATGCACTGATGAAGCCTCCAATAATATGCAACATCTCTTACGTGCATTTGAGGGTTTTTGATATGCTGCTAACCGAGTC
ATTTAATGAGGAGGCAAGTGATGAGACCCTGAGGAGCAAAATCATTGTGGCCCTTCCAATTTTAGACAATCTTCTGCAAAGTATGCTACCATCAGTGACT
CCTGAAGAAAGGTACCAAGGAGTAGGAATATTTGAACAATATGAGAAGTCAGGCTATACGAAGAAGGGCCACCAGTCGTTTGGCTCTAATGCTGAGAAGG
TTCGCCACAGCAAGAAGCGAAACCGTGCTAAGAAAAGGACTCACAAGCAGCAGCAACATATTTTCAAGCGCAATAACTTTGGGGGGAATGTGGCTTTGAA
CCGCTGGTGGTACTTGGACGGCTGCATGCTGATGTCTGTTGGTATGTTGTCACTTTGCTGGATGGCATGGAAGATCTTGCAGTAGATACTAGCTTAGGGC
TGCTTTCAGGCTGCTTTCGTCCTGCTCTTTTGCCTTTCATAATTGTCCTGTCCTGAAACCACCCTACGGAATCATGTACATGTTGTAGCCAGGTTTCGGG
GTGAGCAAGTTGGCTGCAGCTTGCTGCTGAACTAAACAGTATATTACCATAGTCACCTGCTCTTTCGGTGCATCGTATCTTGAACGATAGTTCTGGCAGT
AGTTAGTCACCTGCTCTTTCGGTGCATCGTATCTGAATGATAGT
page-top