Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig960
Contig Information
Length 621 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec10c16    rwhec10c16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100216896 [Zea mays] >gi|194696926|gb|ACF82547.1| unknown [Zea mays]
Score 561
Evalue 5.16069e-56
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig960
GGAGAATGTTACTCTTGGACCTGCTGTCCGTGAAGGGGAGCATGTCTTCGGAGTTGCTCATGTCTTTGCATCATTCAATGACACATTCATCCACGTCACT
GACTTGTCTGGGAGAGAGACCCTTGTTCGTATTACTGGTGGAATGAAGGTCAAGGCTGATCGTGATGAGTCATCACCATATGCAGCTATGCTCGCTTCTC
AAGATGTTGCGACGCGTTGCAAGGAACTTGGCATCACTGCTTTGCACATTAAGCTCCGTGCCACTGGAGGCAACAAGACCAAGACTCCTGGACCTGGTGC
TCAATCCGCTCTCAGGGCACTCGCTCGTTCTGGCATGAAAATTGGACGCATTGAGGACGTGACCCCTGTTCCCACTGACAGCACTCGCAGAAAGGGCGGC
AGGAGAGGAAGGAGGCTGTAGACACCTTCTTTTTCATCGTCTCTCATGGTCGTCATCAAGAATTTGCAGTTTGAGTAGCCTTATTATAGATCCTATGTAG
TCGCCTATCAGTTTACTCTGAGTTCAGAATATTTGACTGTCGCTTAATTCAGAGCTGTGCTTCACTTCAGATCATCTCTGGTCGTGTATTTATGCCAAAG
TATTANTCCGCAAAAAAAAAA
page-top