Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig11
Contig Information
Length 968 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl5k16    rwhfl5k16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_005383 [Oryza sativa (japonica cultivar-group)]
Score 291
Evalue 2.47782e-24
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig11
acagtttcagtctcagttgttacagcctttgcctggaaggaccaagaagaagaagaacagtatacgtgccacacaagccaagagaagatggggcgcggga
ggacggagatgaagaagatccagaacgatgtgtcacggcgggccaccttcggcaagcgccgccgcggcctgctgaagaaggcgcacgagctcgccgtact
ctgcggcgtcgacctcggcctcctcgtcttcGACGACGACGGCgcc*ggcAAGCTGTTCGACTACTGCGCCCCTAACACAAGCTGGAGCGAGCTAATTGA
GCGCTACGAGAGCATCACCAAACACCAGTTCCAGTTCCAGGGCCAGGGGATACATCATGATGATCATCAGCAACCGTCGGCGGATATCATCGCAGGGCTG
AGGCGTGAGGGTGACCATCTGGAGGCCAGCGTGACGAGGCAGACCGGAGAAAACCTGTCATCCACTGCGACGGCGGCGGAACTCGACGAACTGGAGCAGC
GGCTGGAGTGCGTGCTGGGTAAAGTCCGTGAAACGAAGGACAAGTTGCTGGAGCAGCAGTTGGGCGAATcacaccacaaggtgcacatcttggaggacca
gaacagcttccttcgccgcctgatgggcgaggaggggcagcaacgtgctgctgtggaggcgtccgcggtgccgccgaagctaccggaggtggaggaggag
gaattgacgacgctgcggctgtggccgcggcagctccccgacgtgtaaggcataggcctcaagcccagcctgcaactctccatacttgagttgcctgtgt
gcatgtggctgcgggttgcttggatcgatcacgccttattttcaggaagtcctttgtgatagttgataacctcgggacgagacttgaggaaccggtagaa
ctcctcgtccggcggagatactccacgtagcctcgcccgctcttgaggttaaagtctcaaaaaagccg
page-top