Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig426
Contig Information
Length 676 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec17l23    rwhec17l23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os12g0154400 [Oryza sativa (japonica cultivar-group)] >gi|113648693|dbj|BAF29205.1| Os12g0154400 [Oryza sativa (japonica cultivar-group)] >gi|218186455|gb|EEC68882.1| hypothetical protein OsI_37514 [Oryza sativa Indica Group]
Score 598
Evalue 3.2473e-60
Total Hit Count 41
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig426
ATAGCTCACCAGCATGGTGTGGTTTTGATTTTAAGCGAGCGTCTCCACTCAGTAACTGCACAATTTGATCGCCTTAGGTCCCTGCGCTTTCAAGAAGCTA
TTAATAGGGTGATGCCAAGAAAGAAGATCAAGAAGAAGCCAGATATAAAACCTACTGAACCATCCAAGTCAAACCTTGTATTGAAATCTGATGTCTCGAA
GGTTGAAGACCGGGAGGTATCAACTGCGCCCTTAAGAGTTCAAGAACAACTCTTGGACGATGAAACACGAGCTCTCCAGATGGAGTTGACCAATCTTCTT
GATACTGTCCAAGAAACGGAGACAAAGATGATAGAGATGTCAGCACTTAATCATCTTATGTCAACACATGTTCTACAGCAAGCTCAGCAGATTCAATATT
TGTACGACCAGGCGGTGGAAGCAACAAACAACGTGGAGCGTGGGAACAAGGAGCTATCCCAGGCGATCCAGCGGAACAGCAGCAGTAGAACCTTTCTCCT
GCTTTTCTTCTTTGTTCTTACTTTCTCTGTTCTGTTTCTTGACTGGTACAAAAACTGAATTAGCTCATGTAACCGTACTACTGTGCAAATGGATTGAGCT
ATTGACGCCTCGTCTCTTGTGGGATGATAATCACTTGTCGTGCATATTGGTCAGTTTTATTCTCTTAAAAAAAAAA
page-top