Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig1089
Contig Information
Length 617 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 6 Clones [Download: CSV  ,  FASTA ]
whfl10d23    whfl4i09    whfl48e12    whfl30d09    whfl14c03    whfl30d10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit alpha-tubulin [Solanum tuberosum]
Score 750
Evalue 6.18341e-78
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig1089
ctAAGCAGAGCATCGCAGAGACCGGCGTCTTCGTACTCGCCTCTCTCTCGCGCTTCCGAGCTTTGGCCTCCCTCCCCTCCTCCCCGCAATCTCCCCACCA
GCGTAGCGCAGCGCGCGCCTCCGCCGCTCCGACCCGCAGCCATGAGGGAGTGCATCTCGATCCACATCGGCCAGGCCGGCATCCAGGTCGGGAACGCGTG
CTGGGAGCTCTACTGCCTCGAGCATGGCATTCAGCCTGATGGACAGATGCCTGGTGACAAGACCGTTGGGGGAGGTGATGATGCTTTCAACACCTTCTTC
AGTGAGACTGGTGCTGGGAAGCATGTTCCCCGTGCTGTCTTTGTTGATCTTGAGCCCACTGTGATTGATGAGGTGAGGACTGGCACCTATCGCCAGCTCT
TCCACCCTGAGCAGCTTATCAGTGGCAAGGAGGATGCAGCCAACAACTTTGCCCGTGGTCACTACACCATTGGCAAGGAGATTGTTGACCTATGCCTTGA
CCgtatcaggaagcttgcagacaactgcactggtctccagggattccttgtcttcaacgctgttggaggtggaactggctctggccttggttctctcctc
cttgagcgtctctctgt
page-top