Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig337
Contig Information
Length 1038 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec10e12    rwhec10e12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_21379 [Oryza sativa Indica Group]
Score 1354
Evalue 1.50799e-147
Total Hit Count 57
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig337
GGGCGACGTCGCCAACCTCAAGTGCCGGGTCCGGGCCGTCAAGAAGGCCGAGGTCGACAGCCCTGTCGCGATACAGACCATCAAAGGTTACCTCTTGGTG
GCCAGCCAGGACAAGATCATGGTGTACAACACCTCATCTCAGTACTATGGGAGGGTCGGGGCGCCCCGGCCGCTGTTCACCACTGCCATTAGGGACATCA
AGGCTGTGTTTGCGGGTTCTAGCGCCGTCATGTCAGCCGCACCAGCTGGGAAGCCTCTTATTGCCGCGGACCGTGAGAAGCTCGTCATCTTGGGGCTTGG
GGATGGTTACATCGCCATCTACCGTTCCAACTTCCCGGTGTACAAGCCGGAGAGCAATGCTGTTGTGTGGAGTGGCCCGGCGCTGCTTTTCCTCCTGTTC
TTGATTGGCATCTGGCAAGTCTATGTGAAGAAGAAGGATTCGTTGGGATGGACACCGGAGGAGACGTTTAACACCTCGGTCACAGCTCCTACAGGGAGCA
TCTTGAATCATCCAGCCAGTGAGCGAGCATTCGCAGATAGCACGACAAGAGCTGCTGATCGAAGCTATGTGGATGGCACGACCAGAGCCAGCGACAGAAG
CTATGTGGACGCCACTGCGAGATCTACTGACCGAGCCTATGCTGAGGCTACCAGGGCTGTGGACCTACGCGGCGGGGCGTTGAGAAGTGCTCCGAGAAGG
TATGTGTCCCCTACCAGGTATGCAGGGGCAGCCGGTATTCCGTATCGACCTGTTTCGGCCGAGCCCGGGCTTAGAGGAGCCACTCCAGAGCTGAAGTACC
GAGGCCCAGGTATGGAGCCCCCTGGTTTCCCCAAGAAAAGGGAGACATTGTTCTCGAACAACCAAGCCGTAGTAGATGATCACGTCGAATGAGGTCGCCG
GACTGTCGGTGCAGACAGCCGCCCCTAAATTTTGGTCTGGCTTGAAGTTCCCGCACCTAAGAGGGATATATGCCGCTGATCCACCCGCCTGTTGTTGTAA
GTTGTAAAACTCAGGAAATGTTTGTATGGTACGAATAC
page-top