Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig328
Contig Information
Length 527 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec10f22    rwhec10f22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit postsynaptic protein CRIPT [Zea mays] >gi|195628180|gb|ACG35920.1| postsynaptic protein CRIPT [Zea mays] >gi|195638164|gb|ACG38550.1| postsynaptic protein CRIPT [Zea mays]
Score 508
Evalue 4.65721e-50
Total Hit Count 118
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig328
AAAAAACCCGATCACCGGCGGCGGCGGCGGCGGCGGCGATGGTGTGCACCAAGTGCGAGAAGAAGCTGGGGAAGGTGATCGTCCCGGACAAGTGGAAGGA
GGGCGCCAGCAACACCTACGAGGGCGGCGGCCGCAAGATCAACGAGAACAAGCTCCTCTCCAAGAAGAGCAGGTGGACTCCTTACGGAAATACCAAATGC
ATAATCTGCAAGCAACAGGTGCACCAGGACGGTAAATACTGCCACACCTGTGCCTATTCAAAAGGGGTGTGTGCGATGTGTGGCAAGCAAGTGCTGGACA
CGAAGCTGTACAAGCAAAGCAATGTGTGAGCAGGATACTCAAGTGGTGGACTTGGTATGTTTAACATGTAAGATCATGACATCATGTACTAGCGATATTG
CTGTGGAAAAAGGTGTTGTGTGCGTGTTATGAAAAGAGCAATTTTTAACAGTTGTGTAAACCGGGCGTGGTTGTCTCTGTAATTTGCACCCTTGAGCAAT
GTGGATTTTTGCTGCCCNNNAAAAAAA
page-top