Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig326
Contig Information
Length 229 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec10g03    rwhec10g03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit PREDICTED: hypothetical protein [Gallus gallus] (no hit)
Score 74
Evalue 7.94724
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig326
CGGTAGAGCAAGCAAGTCCCTGCGTAACATAGGTGTTCATCCTCGTGTTAAGGCCAAGAATTGTACATCGATGTAAGAGTCCCTGATGTCTGTTTTCTTC
TTCTTCTTCTTCTTCTTCTTCTTCTTTCTGCGGTATACAGGTTTGTATACGGGTATACATGAATTACATACATTTCAAGTAACTTGGATCAGACTCATCA
GAGGGCCGAAAACTGTTTTAAAAAAAAAA
page-top