Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig223
Contig Information
Length 1113 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec10c22    rwhec10c22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit PREDICTED: notochord specific gene 9 protein [Ciona intestinalis]
Score 117
Evalue 0.000465231
Total Hit Count 408
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig223
TATGATCACAAAGCCGCCAAAAAAGGCTAGGGCTGCCGCGAAAGCCGCGAGAAAGACCAACAAGAAACCTAAGAAGAAATCAAGCGCCTCTGATCTGCTT
AAGATGGATGACACCTCTGAGTCGGAGGTAGCCCTTGACTCTCTTGGCTTATTTTTCAACCATCTTATTGACACTGACTATTACCAGGATGACACGGGAG
TCAGCCAAGCAGTTGAAGAAGAGGACAGCAACACGAGAACACCAGACCCGGACCGGTGCAGGAAATTTCTCGATCTTCCTCTGGCGATTCATCTCAGACC
CAGCTGTCGCCTTTCAAGACTGTCCTTGGTGGTCAAGCAAAGCCCAATAAGAAGGTGAAGGTGACAAAACCGGCCGAAGACGCTAAAGTTGCTGAACCGG
ACCAGCAAGCTTCTGCACCAGAAGCCTGTGAACAACAACGAGAAGATCCTGCTTCCAATACTCAAACTGAAATGCCTGAGTTGTCTGTTGATCAAACCAA
CATTAACCCTTCAACTACTGAACCGTCCAGCTTACTTAACCTGCCAGAGACTTATGCTGATGACATTCTGATCACTGGCACTGGTTTTACTGAACCGGGA
AACCCAACTATGTTAGCCAGACATTCTGCCAAGCAAGAAGTCATGGAGAGACGGAAAGTGAAATTTGATGTCTCCCACTATGCTCAATTGAGCAGTAGTG
AAGTATTGTCTGGTTATCTCAATCAAGTACACTCCATCCATGATTTGGAAATTGAAATGGTGAAACAGATGCACCAGAAGTATGAGGCTGCGACTGCTGA
ATTGGAATCTCAACTGAACGACGCCAAGACTCGGCTGGTGGCTCAAGAAAATGAAACCCGGAAGGCTGAGTCGAAATTCTAGTTTAGTGTGACTGAATCA
GAAAAGTTGAAGACCAGCTTTAAGGCGGAGAAAAAGACTTGGGTTGAAGAAAGGAATGTTTTAACGCAGCGGGCCAAGAAAGCAGAAGCAACTCTTCAGG
AGGTGACCACTGAGCCCTCCGTCTTAAAACACCGTGTGTCTCAGATGGTTTCTGCTATCTTCGGTGAGTCGCCTTGTTATTCATCCAAAGTGGGTACTTG
TCACCATAATGTA
page-top