Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig121
Contig Information
Length 626 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec15o05    whec15o06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative cellulose synthase catalytic subunit [Hordeum vulgare]
Score 1085
Evalue 7.41592e-117
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig121
GTCATCAGCTGTGGATACGAGGGACAAGACCGAATGGGGAAAAGAGATTGGCTGGATCTATGGTTCAGTTACTGAAGATATTCTTACTGGGTTTAAAATG
CACGCAAGAGGGTGGATATCAATCTACTGCATGCCACCACGGCCTTGTTTCAAGGGTTCTGCGCCAATCAATCTGTCTGACCGTCTTAATCAAGTGCTCC
GATGGGCCCTTGGGTCAGTTGAAATTCTGTTTAGCAGACATTGTCCTATCTGGTACAATTACGGTGGGCGGTTGAAACTTCTGGAGAGGGTGGCTTACAT
CAACACCATTGTTTATCCATTAACATCCCTCCCACTTATCGCCTATTGTGTGCTTCCTGCTATCTGCCTCCTCACCAACAAATTTATCATCCCCGAGATC
AGTAATTATGCTGGGATGTTCTTCATTCTCATGTTTGCCTCCATCTTTGCCACTGGTATATTGGAGCTCCGATGGAGTGGTGTCGGCATCGAGGACTGGT
GGAGAAACGAGCAGTTCTGGGTTATCGGTGGCACATCTGCCCATCTTTTCGCGGTGTTCCAGGGTCTGCTCAAGGTGCTGGCCGGGATCGACACCAACTT
CACTGTCACATCCAAGGCGAACGACG
page-top