Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig100
Contig Information
Length 809 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec14b09    rwhec14b09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative high mobility group protein [Triticum aestivum]
Score 283
Evalue 3.48505e-38
Total Hit Count 118
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig100
CATTCCCTCCGCTCCCACTCCGCAGCAGTTCCGCACCGACGCCCTCGCCCTCACCCTCCCCAAAGCCCTAACCGCTCGCCCGCTCCGCCGCCATGAGGTC
CAAGGCCAACGGAGACACCGCGTTCAAGGCCTCCGGCAAGAACAAGACGGCCACCGGCGGCGTCGCCAAGCCGAAGCGCGCCCCCACCCCCTTCTTCGCC
TTCCTGGCTGAGTTCAGGCCACAGTACATGGAGAAGCACCCCGAGGCAAAGGGCGTCGCGGCCGTGAGTCTCCCACCCTCCTGCCATAGGGTTTTGCTTT
TAGGGTTTTGCATCTAGGGTTTCGTTTCCATTGCCCATGGCTCATAAGTGTGTGCATGTGCTGCTTGTTTTTCTCTCCTTTTAGGTCACCAAGGCGGCTG
GGGAGAAGTGGCGCAGCATGTCGGATGAGGAGAAGGCAAAGTATGGCGGCAAGAAGGCAGATGCCCCAGCAAGCAAGGCGGTGAACAAGAAGGAGAGCAC
TAGCTCCAAGAAGGCCAAGACTGACGCTGACGAAGAAGGTTCTGACGTTGAGGATGATGGCGAGGAGGACGAGGAGTAAATAGTAGATGAGGGAACAGCA
GTGGTGCAAATCAGCGTTTGCTGCTTAGGGTTTAGCTTGCCATGTCGATGTCCTCATTATGTAATGTTATGTAAGGAGAATGTTTAGATGCGTACTCCTG
GGCTGTGGCATGCTAGAGATGTCTCTGTTTGACTATTAGCGAAGAAAAGCTTAAAACCCTTGACTGCTTTTCTTTCTTGGACTTCCACAGCATGTGGAAA
CAGTCATTA
page-top