Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig98
Contig Information
Length 538 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec15l05    rwhec15l05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195622750|gb|ACG33205.1| 60S acidic ribosomal protein P3 [Zea mays] >gi|195654339|gb|ACG46637.1| 60S acidic ribosomal protein P3 [Zea mays]
Score 267
Evalue 4.35993e-22
Total Hit Count 23
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig98
TCCAGACGCCTCCTCCTCCTCCCCCGCCGCCGCCGCACGCTCCAGAGACCGCAGGCATGGGCGTCTTCACCTTCGTGTGCCGCGACTCCGGCGCCGAGTG
GTCGGCCAAGCAGCACAAGGGCGAGCTCGAGGCCTCCGCCGCCACGCCCTACGACCTGCAGCGCCAGCTCGTCTCCGCCGCCTGCGCCGAGGACAAGTCC
GGCGGCGTCCAGTCCTCCTTCACCATGGTCTCCCCCAATTCCGCCATCTTCCAGGTGGTCATTGGTGGTGCCTCTGCTGGTCCGATCGGTGGTGGTGCTG
GTGGTGGTGGTGCCGCTGCATCAGGTGGAGCTGCCGCAGAGGCCCCCAAGGCTGAGGAGAAGAAGGAAGAGGAGAAGGAGGAGAGCGAGGATGACCTTGG
CTTCTCCCTCTTCGATTAGATCTTCTTTACCCTGTTGCTCGCCAGAAATGACATTGTCCTATTGCCGCAGTAATTTTGATGCCATGCCCACAGGGTTTGT
GAACCTGCCTAGTTTGATTGTTCAAGGGATGTATGTGT
page-top