Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig97
Contig Information
Length 848 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec14b16    rwhec14b16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit UBC13B/UBC36 (UBIQUITIN-CONJUGATING ENZYME 36); ubiquitin-protein ligase [Arabidopsis thaliana] >gi|75334547|sp|Q9FZ48|UBC36_ARATH RecName: Full=Ubiquitin carrier protein E2 36 >gi|9802775|gb|AAF99844.1|AC051629_11 Putative ubiquitin-conjugating enzyme E2 [Arabidopsis thaliana] >gi|15450413|gb|AAK96500.1| At1g16890/F17F16.16 [Arabidopsis thaliana] >gi|16974499|gb|AAL31253.1| At1g16890/F17F16.16 [Arabidopsis thaliana] >gi|21555312|gb|AAM63831.1| E2, ubiquitin-conjugating enzyme, putative [Arabidopsis thaliana] >gi|66354480|gb|AAY44875.1| ubiquitinating enzyme [Arabidopsis thaliana]
Score 785
Evalue 1.03985e-81
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig97
CTCGTCGCCCATCCATCCTCCCTCCCCCCGACCGATTTTGACGACTCCTTTGACCTCTCGCGCTGTCCCTCCCCGCCCCGCCTGCGTCGCCGCGCCGAGC
TCCAGGCGCCCCCCCTCCGGTCGGATTCCATGGCCAACAGCAACCTCCCCCGCCGGATCATCAAGGAGACGCAGCGGCTGCTCAGCGAGCCAGCGCCCGG
GATCAGCGCCTCGCCGTCGGAGGAGAACATGCGCTACTTCAATGTCATGGTCCTTGGCCCCGCGCAGTCGCCCTACGAAGGTGGAGTCTTCAAGCTTGAA
CTTTTCTTACCCGAGGAATATCCGATGGCTGCTCCTAAAGTTAGGTTTCTCACAAAAATATACCATCCCAACATTGACAAGCTTGGTAGAATATGCCTCG
ACATCCTAAAGGACAAGTGGAGTCCAGCTCTTCAGATACGCACTGTTCTTTTGAGCATTCAGGCACTGCTGAGCGCCCCAAACCCAGATGATCCTCTCTC
AGAAAACGTCGCAAAACACTGGAAATCCAATGAAGCTGAAGCTGTTGAGACAGCGAAGGAATGGACTCGTATGTATGCCAGTGGCGCATGACAAGCTAAC
GCTGTTATGGATGTAATAACACCGTGTCATAGTTGGGCCTAATCGAAAACCATTTGCTTGATAAAAACACACTTGAAATGATTTGCGATGGACGAATGTA
TCCAGAAGCGGCATCATTTCTAGTTGGTGGTTGTATTTGTGGTGCGTGTTCTGGCACGCTTCATAACTTGCTGCTTATAGAACACGCTCTGTTTCTCGTT
CATCTTCAATTGTTTCTCCAATTAAAAGTATCTGTTGTGATCCGAGTA
page-top