Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig96
Contig Information
Length 1023 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec15l02    rwhec15l02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0515700 [Oryza sativa (japonica cultivar-group)] >gi|113611313|dbj|BAF21691.1| Os07g0515700 [Oryza sativa (japonica cultivar-group)]
Score 268
Evalue 1.26178e-21
Total Hit Count 32
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig96
AAGCCTGTTTTCTTGACTTCTGACTGTACTCATCTTGGCCTAATCTCGGTTCCAGGTACTGTTTTAAAGACTGTACTCATTTTTGTGCCATGCATTGTGC
TGGTTCAACAGCTTTTTATGTTGCTTAAGCATGCTACTTAATTACTACACTGCAGNAAGATCATTTATATCTAATGATGAAACACCAATGTTGTGTATTG
ATCAACATAATACTCCCTTTCCCATAATATAAGATCATATTATGGGATGGAGGGAGTACATCTCAAGCGAGAGGTACTGGCTGGAAGCATGGATGTTTCT
ATTTTTTTATGATGTACCTCTACTGAAATATGTGACAGGCTGTGAGAAAGAAAGTAGGCGGAGGATGGGATCCCACGTATACAAAGAGAAGCTTTTTCCC
ATATTGGAGATCAGTGTTACAAGCTCGGGTTCCTTTGAAGGTGTATCCAGCCCATGCAAGCTCAGATCCTAGGTCTCGTGTTAACCATGGACAACTCCAT
GTCTCTCTGAGTAACTCAATAGCCAATGGATCTACAACAACTCCAAATCATAAACTTGGTCCAGTGCGAAGAACCTCGCCACTTACAAGCAATAATCAAC
CCAGAAGGTGCTTTGTCACTGCTGCTACTGGTGCATTCAGGCTCTTGAAGGTGCTAAGTAGAGTAGAAAGTTGATCGCCAAAGGAAGGCTGGTGATCTCT
GGATTGAGTGGGAAAAATGACTGGCATGAACTAAATTTCTGGCCTATGACGCCGAACGATGTGTCAATGTGTCAATGTGCCTGAATCTGCATTGGCATGG
GAGGATTTCGTATTTTCATTTCCTTTTTGTCCACGTCATTTTCTTTTTCTACCAAACTGTTCTGATTTTGTCGATTTCCTTCTGTTCTGGTGAATTGTGC
AGGAGGCTCAACTGATGCCTGACTTGATAGCCGCTGTGACCCCAGTCATTTAGATGTGGTGTTGTAAGTGTCAAATGTGTGTGATTTTGTTCTCTCGTCA
TCGAATAGAACTGGATGGAGATG
page-top