Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig93
Contig Information
Length 988 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec14c05    rwhec14c05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0609600 [Oryza sativa (japonica cultivar-group)] >gi|51090372|dbj|BAD35633.1| calcium-binding EF hand-like protein [Oryza sativa Japonica Group] >gi|51091947|dbj|BAD35476.1| calcium-binding EF hand-like protein [Oryza sativa Japonica Group] >gi|113596086|dbj|BAF19960.1| Os06g0609600 [Oryza sativa (japonica cultivar-group)] >gi|125556028|gb|EAZ01634.1| hypothetical protein OsI_23671 [Oryza sativa Indica Group] >gi|125597826|gb|EAZ37606.1| hypothetical protein OsJ_021089 [Oryza sativa (japonica cultivar-group)] >gi|215704179|dbj|BAG93019.1| unnamed protein product [Oryza sativa Japonica Group]
Score 976
Evalue 9.54422e-104
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig93
AGGGCGAAGTGGGAAAAATATCGCACCTCCCTCGCCGCCGATCAGCGCCTCCGGTTCCGGATCCCCGCGCGTATCCGCATCGCCGGCTTCCTCGCGCAGG
CAAGGTGCTGCTACTGTTCGCTCATTTGCTCTGTATCCAGTTGTGGGCACTGAGGGAACTGAAGTGCTGGCATGGGAGGCGTGTTTGGACGCCCCGACGC
CGGCAGGCAGGGCTCGCATGGCATGAAGCTAGAGTCGAAGATGGTGGAGTCCATGAAGCAGAGAGCGGCGCATGGAACTTCGGTCAAGTCGTTCAATACT
ATTATCATGAAGTTCCCCAAAATCGACGAGGGCTTGAGAAAATGCAAGACTATCTTTGAGCAATTCGATGAAGATTCCAATGGTGAAATTGATAAAGAAG
AGCTGAAGCATTGTTTTCAGAAGCTGGAAATCTCATTCACAGAGGAGATAGGCGATCTCTTTGAAGCTTGCGACATAAATGAAGATATGGGCATGAAGTA
CAATGAGTTCATTGTCTTTCTGTGCCTTGTTTATCTTCTCAATGATCCGACTGCGTCAGAAGCAAAGACAAAGATGGGATTAGGAGATCTTGAGTCAACT
TTTGAGACCTTGGTTGATGCATTTGTCTTCTTGGATAAGAATAAGGACGGGTATGTGAGCAAGGATGAGATGATTCAAGCAATAAATGAGAGCATACCAG
GGGAACGCTCCGCTGGCCGTATAGCCATGAAAAGATTTGAGGAGATGGATTGGGACAAGAATGGGATGGTTACCTTCAAGGAATTCCTGTTTGCATTCAC
TCGCTGGGTAGGGATTGGCGAAAATGAGGACGACGATGAATGAACGATGTGGAAGCGACAGCTGAAGAATGGCTGACTATAAATTGGTTGCATGGTGGTT
TTATCTTCCTGTTAATAGTGACTCGGCATGTTCCAAATAGAATGACTGACATGTCTGAACACCTGTATCAAACCAGTGTCTGTGACTG
page-top