Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig92
Contig Information
Length 274 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 2 Clones [Download: CSV  ,  FASTA ]
whec15k10    rwhec15k10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hCG16178, isoform CRA_b [Homo sapiens]
Score 78
Evalue 2.68917
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig92
CATGAACATGACTAATCTAGTACTCCCTCCGTCCGGAAATACTCGTCGGAGGAATGGATGTATCTAGATGTATTTTAGTTTTAGATACATTCATTTTTAT
GCATTTCTCCGACAAGTATTTCCGGACGGAGGGAGTACTGTAGTACCAAGTGGGAATTGGGTCTGGGGACAAATCATCATAATTGTTTCACTGAACGATA
AATGTATCTTCCGAACGATCGGAAACTCGCAACGGATCCGAACTTAGGGATGCCGTTCATTTTGAAAAAAAAAA
page-top